ID: 952664714

View in Genome Browser
Species Human (GRCh38)
Location 3:35890328-35890350
Sequence TTCTATGAGGATATAGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952664714_952664720 -10 Left 952664714 3:35890328-35890350 CCTGCCCCTATATCCTCATAGAA No data
Right 952664720 3:35890341-35890363 CCTCATAGAATTATCTATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952664714 Original CRISPR TTCTATGAGGATATAGGGGC AGG (reversed) Intergenic
No off target data available for this crispr