ID: 952670035

View in Genome Browser
Species Human (GRCh38)
Location 3:35955308-35955330
Sequence ATGGGTCCAGCACTTGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952670030_952670035 8 Left 952670030 3:35955277-35955299 CCTGGAGAAAGGAAAATCAGGAT No data
Right 952670035 3:35955308-35955330 ATGGGTCCAGCACTTGGCAGAGG No data
952670026_952670035 19 Left 952670026 3:35955266-35955288 CCATAAAACACCCTGGAGAAAGG No data
Right 952670035 3:35955308-35955330 ATGGGTCCAGCACTTGGCAGAGG No data
952670029_952670035 9 Left 952670029 3:35955276-35955298 CCCTGGAGAAAGGAAAATCAGGA No data
Right 952670035 3:35955308-35955330 ATGGGTCCAGCACTTGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952670035 Original CRISPR ATGGGTCCAGCACTTGGCAG AGG Intergenic
No off target data available for this crispr