ID: 952673666

View in Genome Browser
Species Human (GRCh38)
Location 3:36000751-36000773
Sequence GACTCAGCTGTTCCAACCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952673666_952673668 -4 Left 952673666 3:36000751-36000773 CCACAGGTTGGAACAGCTGAGTC No data
Right 952673668 3:36000770-36000792 AGTCATCCAACCAACCCAGGTGG No data
952673666_952673674 14 Left 952673666 3:36000751-36000773 CCACAGGTTGGAACAGCTGAGTC No data
Right 952673674 3:36000788-36000810 GGTGGTGGCCCTCCTTCCCCTGG No data
952673666_952673679 29 Left 952673666 3:36000751-36000773 CCACAGGTTGGAACAGCTGAGTC No data
Right 952673679 3:36000803-36000825 TCCCCTGGGCACTCTGTCTCAGG No data
952673666_952673667 -7 Left 952673666 3:36000751-36000773 CCACAGGTTGGAACAGCTGAGTC No data
Right 952673667 3:36000767-36000789 CTGAGTCATCCAACCAACCCAGG No data
952673666_952673675 15 Left 952673666 3:36000751-36000773 CCACAGGTTGGAACAGCTGAGTC No data
Right 952673675 3:36000789-36000811 GTGGTGGCCCTCCTTCCCCTGGG No data
952673666_952673669 -1 Left 952673666 3:36000751-36000773 CCACAGGTTGGAACAGCTGAGTC No data
Right 952673669 3:36000773-36000795 CATCCAACCAACCCAGGTGGTGG No data
952673666_952673681 30 Left 952673666 3:36000751-36000773 CCACAGGTTGGAACAGCTGAGTC No data
Right 952673681 3:36000804-36000826 CCCCTGGGCACTCTGTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952673666 Original CRISPR GACTCAGCTGTTCCAACCTG TGG (reversed) Intergenic
No off target data available for this crispr