ID: 952676039

View in Genome Browser
Species Human (GRCh38)
Location 3:36031122-36031144
Sequence ACCAGATGGTTGAGGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952676039_952676044 24 Left 952676039 3:36031122-36031144 CCCAGGGCCCTCAACCATCTGGT No data
Right 952676044 3:36031169-36031191 CATCATTTCAGAGATTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952676039 Original CRISPR ACCAGATGGTTGAGGGCCCT GGG (reversed) Intergenic
No off target data available for this crispr