ID: 952682981

View in Genome Browser
Species Human (GRCh38)
Location 3:36117265-36117287
Sequence CTGATTCCTAGCATTCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952682981_952682985 7 Left 952682981 3:36117265-36117287 CCCAGCAGAATGCTAGGAATCAG No data
Right 952682985 3:36117295-36117317 TTCTGAGCCAATGTGATCAGAGG No data
952682981_952682986 8 Left 952682981 3:36117265-36117287 CCCAGCAGAATGCTAGGAATCAG No data
Right 952682986 3:36117296-36117318 TCTGAGCCAATGTGATCAGAGGG No data
952682981_952682989 20 Left 952682981 3:36117265-36117287 CCCAGCAGAATGCTAGGAATCAG No data
Right 952682989 3:36117308-36117330 TGATCAGAGGGAAAGAGGTATGG No data
952682981_952682988 15 Left 952682981 3:36117265-36117287 CCCAGCAGAATGCTAGGAATCAG No data
Right 952682988 3:36117303-36117325 CAATGTGATCAGAGGGAAAGAGG No data
952682981_952682990 21 Left 952682981 3:36117265-36117287 CCCAGCAGAATGCTAGGAATCAG No data
Right 952682990 3:36117309-36117331 GATCAGAGGGAAAGAGGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952682981 Original CRISPR CTGATTCCTAGCATTCTGCT GGG (reversed) Intergenic
No off target data available for this crispr