ID: 952682982

View in Genome Browser
Species Human (GRCh38)
Location 3:36117266-36117288
Sequence CCTGATTCCTAGCATTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952682982_952682988 14 Left 952682982 3:36117266-36117288 CCAGCAGAATGCTAGGAATCAGG No data
Right 952682988 3:36117303-36117325 CAATGTGATCAGAGGGAAAGAGG No data
952682982_952682989 19 Left 952682982 3:36117266-36117288 CCAGCAGAATGCTAGGAATCAGG No data
Right 952682989 3:36117308-36117330 TGATCAGAGGGAAAGAGGTATGG No data
952682982_952682985 6 Left 952682982 3:36117266-36117288 CCAGCAGAATGCTAGGAATCAGG No data
Right 952682985 3:36117295-36117317 TTCTGAGCCAATGTGATCAGAGG No data
952682982_952682990 20 Left 952682982 3:36117266-36117288 CCAGCAGAATGCTAGGAATCAGG No data
Right 952682990 3:36117309-36117331 GATCAGAGGGAAAGAGGTATGGG No data
952682982_952682986 7 Left 952682982 3:36117266-36117288 CCAGCAGAATGCTAGGAATCAGG No data
Right 952682986 3:36117296-36117318 TCTGAGCCAATGTGATCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952682982 Original CRISPR CCTGATTCCTAGCATTCTGC TGG (reversed) Intergenic
No off target data available for this crispr