ID: 952682988

View in Genome Browser
Species Human (GRCh38)
Location 3:36117303-36117325
Sequence CAATGTGATCAGAGGGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952682981_952682988 15 Left 952682981 3:36117265-36117287 CCCAGCAGAATGCTAGGAATCAG No data
Right 952682988 3:36117303-36117325 CAATGTGATCAGAGGGAAAGAGG No data
952682982_952682988 14 Left 952682982 3:36117266-36117288 CCAGCAGAATGCTAGGAATCAGG No data
Right 952682988 3:36117303-36117325 CAATGTGATCAGAGGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952682988 Original CRISPR CAATGTGATCAGAGGGAAAG AGG Intergenic
No off target data available for this crispr