ID: 952683231

View in Genome Browser
Species Human (GRCh38)
Location 3:36120146-36120168
Sequence GGTGGGTTATCTATACTTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952683231_952683238 28 Left 952683231 3:36120146-36120168 CCGTCAAGTATAGATAACCCACC No data
Right 952683238 3:36120197-36120219 TCTATATAAATGCTCTGGGTAGG No data
952683231_952683236 23 Left 952683231 3:36120146-36120168 CCGTCAAGTATAGATAACCCACC No data
Right 952683236 3:36120192-36120214 CCTTATCTATATAAATGCTCTGG No data
952683231_952683237 24 Left 952683231 3:36120146-36120168 CCGTCAAGTATAGATAACCCACC No data
Right 952683237 3:36120193-36120215 CTTATCTATATAAATGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952683231 Original CRISPR GGTGGGTTATCTATACTTGA CGG (reversed) Intergenic