ID: 952683232

View in Genome Browser
Species Human (GRCh38)
Location 3:36120163-36120185
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952683232_952683238 11 Left 952683232 3:36120163-36120185 CCCACCTTACTTAGAATATCTCT No data
Right 952683238 3:36120197-36120219 TCTATATAAATGCTCTGGGTAGG No data
952683232_952683239 17 Left 952683232 3:36120163-36120185 CCCACCTTACTTAGAATATCTCT No data
Right 952683239 3:36120203-36120225 TAAATGCTCTGGGTAGGTATTGG No data
952683232_952683243 27 Left 952683232 3:36120163-36120185 CCCACCTTACTTAGAATATCTCT No data
Right 952683243 3:36120213-36120235 GGGTAGGTATTGGGGGAAGCTGG No data
952683232_952683240 18 Left 952683232 3:36120163-36120185 CCCACCTTACTTAGAATATCTCT No data
Right 952683240 3:36120204-36120226 AAATGCTCTGGGTAGGTATTGGG No data
952683232_952683236 6 Left 952683232 3:36120163-36120185 CCCACCTTACTTAGAATATCTCT No data
Right 952683236 3:36120192-36120214 CCTTATCTATATAAATGCTCTGG No data
952683232_952683241 19 Left 952683232 3:36120163-36120185 CCCACCTTACTTAGAATATCTCT No data
Right 952683241 3:36120205-36120227 AATGCTCTGGGTAGGTATTGGGG No data
952683232_952683237 7 Left 952683232 3:36120163-36120185 CCCACCTTACTTAGAATATCTCT No data
Right 952683237 3:36120193-36120215 CTTATCTATATAAATGCTCTGGG No data
952683232_952683242 20 Left 952683232 3:36120163-36120185 CCCACCTTACTTAGAATATCTCT No data
Right 952683242 3:36120206-36120228 ATGCTCTGGGTAGGTATTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952683232 Original CRISPR AGAGATATTCTAAGTAAGGT GGG (reversed) Intergenic