ID: 952683234

View in Genome Browser
Species Human (GRCh38)
Location 3:36120167-36120189
Sequence ACTAAGAGATATTCTAAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952683234_952683240 14 Left 952683234 3:36120167-36120189 CCTTACTTAGAATATCTCTTAGT No data
Right 952683240 3:36120204-36120226 AAATGCTCTGGGTAGGTATTGGG No data
952683234_952683238 7 Left 952683234 3:36120167-36120189 CCTTACTTAGAATATCTCTTAGT No data
Right 952683238 3:36120197-36120219 TCTATATAAATGCTCTGGGTAGG No data
952683234_952683239 13 Left 952683234 3:36120167-36120189 CCTTACTTAGAATATCTCTTAGT No data
Right 952683239 3:36120203-36120225 TAAATGCTCTGGGTAGGTATTGG No data
952683234_952683243 23 Left 952683234 3:36120167-36120189 CCTTACTTAGAATATCTCTTAGT No data
Right 952683243 3:36120213-36120235 GGGTAGGTATTGGGGGAAGCTGG No data
952683234_952683237 3 Left 952683234 3:36120167-36120189 CCTTACTTAGAATATCTCTTAGT No data
Right 952683237 3:36120193-36120215 CTTATCTATATAAATGCTCTGGG No data
952683234_952683241 15 Left 952683234 3:36120167-36120189 CCTTACTTAGAATATCTCTTAGT No data
Right 952683241 3:36120205-36120227 AATGCTCTGGGTAGGTATTGGGG No data
952683234_952683236 2 Left 952683234 3:36120167-36120189 CCTTACTTAGAATATCTCTTAGT No data
Right 952683236 3:36120192-36120214 CCTTATCTATATAAATGCTCTGG No data
952683234_952683242 16 Left 952683234 3:36120167-36120189 CCTTACTTAGAATATCTCTTAGT No data
Right 952683242 3:36120206-36120228 ATGCTCTGGGTAGGTATTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952683234 Original CRISPR ACTAAGAGATATTCTAAGTA AGG (reversed) Intergenic