ID: 952683238

View in Genome Browser
Species Human (GRCh38)
Location 3:36120197-36120219
Sequence TCTATATAAATGCTCTGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952683233_952683238 10 Left 952683233 3:36120164-36120186 CCACCTTACTTAGAATATCTCTT No data
Right 952683238 3:36120197-36120219 TCTATATAAATGCTCTGGGTAGG No data
952683232_952683238 11 Left 952683232 3:36120163-36120185 CCCACCTTACTTAGAATATCTCT No data
Right 952683238 3:36120197-36120219 TCTATATAAATGCTCTGGGTAGG No data
952683234_952683238 7 Left 952683234 3:36120167-36120189 CCTTACTTAGAATATCTCTTAGT No data
Right 952683238 3:36120197-36120219 TCTATATAAATGCTCTGGGTAGG No data
952683231_952683238 28 Left 952683231 3:36120146-36120168 CCGTCAAGTATAGATAACCCACC No data
Right 952683238 3:36120197-36120219 TCTATATAAATGCTCTGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952683238 Original CRISPR TCTATATAAATGCTCTGGGT AGG Intergenic