ID: 952683983

View in Genome Browser
Species Human (GRCh38)
Location 3:36129265-36129287
Sequence CTTGCCAAGCTGCAGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952683978_952683983 13 Left 952683978 3:36129229-36129251 CCAAACTCTGGGAGCAAAAGAAC No data
Right 952683983 3:36129265-36129287 CTTGCCAAGCTGCAGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952683983 Original CRISPR CTTGCCAAGCTGCAGGTGGT GGG Intergenic
No off target data available for this crispr