ID: 952685616 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:36144627-36144649 |
| Sequence | AGGAATTCACAGTTGGAGTA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 952685616_952685619 | 0 | Left | 952685616 | 3:36144627-36144649 | CCATACTCCAACTGTGAATTCCT | No data | ||
| Right | 952685619 | 3:36144650-36144672 | ACTAGCTAAGAGTAAGTCACAGG | No data | ||||
| 952685616_952685620 | 15 | Left | 952685616 | 3:36144627-36144649 | CCATACTCCAACTGTGAATTCCT | No data | ||
| Right | 952685620 | 3:36144665-36144687 | GTCACAGGTGCGCACAGAAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 952685616 | Original CRISPR | AGGAATTCACAGTTGGAGTA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||