ID: 952685616

View in Genome Browser
Species Human (GRCh38)
Location 3:36144627-36144649
Sequence AGGAATTCACAGTTGGAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952685616_952685619 0 Left 952685616 3:36144627-36144649 CCATACTCCAACTGTGAATTCCT No data
Right 952685619 3:36144650-36144672 ACTAGCTAAGAGTAAGTCACAGG No data
952685616_952685620 15 Left 952685616 3:36144627-36144649 CCATACTCCAACTGTGAATTCCT No data
Right 952685620 3:36144665-36144687 GTCACAGGTGCGCACAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952685616 Original CRISPR AGGAATTCACAGTTGGAGTA TGG (reversed) Intergenic
No off target data available for this crispr