ID: 952687350

View in Genome Browser
Species Human (GRCh38)
Location 3:36164901-36164923
Sequence CTTTGGAAGGTGAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148242
Summary {0: 5, 1: 125, 2: 2466, 3: 32371, 4: 113275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952687343_952687350 -8 Left 952687343 3:36164886-36164908 CCTGTAATCCCAGCACTTTGGAA 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705
Right 952687350 3:36164901-36164923 CTTTGGAAGGTGAAGGTGGGTGG 0: 5
1: 125
2: 2466
3: 32371
4: 113275
952687341_952687350 11 Left 952687341 3:36164867-36164889 CCAGGCATGGTGGCTTATGCCTG 0: 744
1: 11196
2: 48611
3: 122023
4: 206147
Right 952687350 3:36164901-36164923 CTTTGGAAGGTGAAGGTGGGTGG 0: 5
1: 125
2: 2466
3: 32371
4: 113275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952687350 Original CRISPR CTTTGGAAGGTGAAGGTGGG TGG Intergenic
Too many off-targets to display for this crispr