ID: 952687513

View in Genome Browser
Species Human (GRCh38)
Location 3:36167290-36167312
Sequence GAGGGTGAAGAATGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952687513_952687521 3 Left 952687513 3:36167290-36167312 CCCTCCTCCCATTCTTCACCCTC No data
Right 952687521 3:36167316-36167338 TAGGCCACTTTCTTTATATCTGG No data
952687513_952687524 16 Left 952687513 3:36167290-36167312 CCCTCCTCCCATTCTTCACCCTC No data
Right 952687524 3:36167329-36167351 TTATATCTGGAATTCTTCTTGGG No data
952687513_952687523 15 Left 952687513 3:36167290-36167312 CCCTCCTCCCATTCTTCACCCTC No data
Right 952687523 3:36167328-36167350 TTTATATCTGGAATTCTTCTTGG No data
952687513_952687525 24 Left 952687513 3:36167290-36167312 CCCTCCTCCCATTCTTCACCCTC No data
Right 952687525 3:36167337-36167359 GGAATTCTTCTTGGGATCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952687513 Original CRISPR GAGGGTGAAGAATGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr