ID: 952688573

View in Genome Browser
Species Human (GRCh38)
Location 3:36176911-36176933
Sequence GTTTAAGCACAGAGGGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952688568_952688573 28 Left 952688568 3:36176860-36176882 CCTGAAGACTATGGGAAGATTTC No data
Right 952688573 3:36176911-36176933 GTTTAAGCACAGAGGGCTGTAGG No data
952688570_952688573 -7 Left 952688570 3:36176895-36176917 CCAGAAAGTCACACTGGTTTAAG No data
Right 952688573 3:36176911-36176933 GTTTAAGCACAGAGGGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952688573 Original CRISPR GTTTAAGCACAGAGGGCTGT AGG Intergenic
No off target data available for this crispr