ID: 952689479

View in Genome Browser
Species Human (GRCh38)
Location 3:36187795-36187817
Sequence CCATTGTCACCAAAACAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952689479_952689482 2 Left 952689479 3:36187795-36187817 CCACGCTGTTTTGGTGACAATGG No data
Right 952689482 3:36187820-36187842 TTATAGTACAGTTTGAAATCAGG 0: 26
1: 517
2: 1766
3: 15648
4: 9309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952689479 Original CRISPR CCATTGTCACCAAAACAGCG TGG (reversed) Intergenic
No off target data available for this crispr