ID: 952689482

View in Genome Browser
Species Human (GRCh38)
Location 3:36187820-36187842
Sequence TTATAGTACAGTTTGAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27266
Summary {0: 26, 1: 517, 2: 1766, 3: 15648, 4: 9309}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952689479_952689482 2 Left 952689479 3:36187795-36187817 CCACGCTGTTTTGGTGACAATGG No data
Right 952689482 3:36187820-36187842 TTATAGTACAGTTTGAAATCAGG 0: 26
1: 517
2: 1766
3: 15648
4: 9309
952689476_952689482 20 Left 952689476 3:36187777-36187799 CCTATTTTTACACCGGTACCACG No data
Right 952689482 3:36187820-36187842 TTATAGTACAGTTTGAAATCAGG 0: 26
1: 517
2: 1766
3: 15648
4: 9309
952689478_952689482 8 Left 952689478 3:36187789-36187811 CCGGTACCACGCTGTTTTGGTGA 0: 28
1: 966
2: 14734
3: 9235
4: 6085
Right 952689482 3:36187820-36187842 TTATAGTACAGTTTGAAATCAGG 0: 26
1: 517
2: 1766
3: 15648
4: 9309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952689482 Original CRISPR TTATAGTACAGTTTGAAATC AGG Intergenic
Too many off-targets to display for this crispr