ID: 952690135

View in Genome Browser
Species Human (GRCh38)
Location 3:36195931-36195953
Sequence CCACTTTGATATACTTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952690135_952690139 1 Left 952690135 3:36195931-36195953 CCTGGGCAAGTATATCAAAGTGG No data
Right 952690139 3:36195955-36195977 TCTGGATACAAAAAAACAGGTGG No data
952690135_952690138 -2 Left 952690135 3:36195931-36195953 CCTGGGCAAGTATATCAAAGTGG No data
Right 952690138 3:36195952-36195974 GGATCTGGATACAAAAAAACAGG No data
952690135_952690142 23 Left 952690135 3:36195931-36195953 CCTGGGCAAGTATATCAAAGTGG No data
Right 952690142 3:36195977-36195999 GAACATGTAACAGGATGGTATGG No data
952690135_952690140 14 Left 952690135 3:36195931-36195953 CCTGGGCAAGTATATCAAAGTGG No data
Right 952690140 3:36195968-36195990 AAACAGGTGGAACATGTAACAGG No data
952690135_952690143 24 Left 952690135 3:36195931-36195953 CCTGGGCAAGTATATCAAAGTGG No data
Right 952690143 3:36195978-36196000 AACATGTAACAGGATGGTATGGG No data
952690135_952690144 25 Left 952690135 3:36195931-36195953 CCTGGGCAAGTATATCAAAGTGG No data
Right 952690144 3:36195979-36196001 ACATGTAACAGGATGGTATGGGG No data
952690135_952690141 18 Left 952690135 3:36195931-36195953 CCTGGGCAAGTATATCAAAGTGG No data
Right 952690141 3:36195972-36195994 AGGTGGAACATGTAACAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952690135 Original CRISPR CCACTTTGATATACTTGCCC AGG (reversed) Intergenic
No off target data available for this crispr