ID: 952691467

View in Genome Browser
Species Human (GRCh38)
Location 3:36211381-36211403
Sequence TGCCATTTATAGATCTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952691467_952691471 4 Left 952691467 3:36211381-36211403 CCCTGGGAGATCTATAAATGGCA No data
Right 952691471 3:36211408-36211430 ACACACATGAGAGTAGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952691467 Original CRISPR TGCCATTTATAGATCTCCCA GGG (reversed) Intergenic
No off target data available for this crispr