ID: 952691731

View in Genome Browser
Species Human (GRCh38)
Location 3:36215006-36215028
Sequence GAAAAGGCACAGATACAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952691731_952691737 14 Left 952691731 3:36215006-36215028 CCCTTCTGTATCTGTGCCTTTTC No data
Right 952691737 3:36215043-36215065 TTGGAAAAAATATAAATAATTGG No data
952691731_952691734 -5 Left 952691731 3:36215006-36215028 CCCTTCTGTATCTGTGCCTTTTC No data
Right 952691734 3:36215024-36215046 TTTTCTTCCAGACATACCTTTGG No data
952691731_952691738 15 Left 952691731 3:36215006-36215028 CCCTTCTGTATCTGTGCCTTTTC No data
Right 952691738 3:36215044-36215066 TGGAAAAAATATAAATAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952691731 Original CRISPR GAAAAGGCACAGATACAGAA GGG (reversed) Intergenic
No off target data available for this crispr