ID: 952693879

View in Genome Browser
Species Human (GRCh38)
Location 3:36242973-36242995
Sequence CTGTGTGCTCTCTTTGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952693879_952693885 17 Left 952693879 3:36242973-36242995 CCTGAGCCAAAGAGAGCACACAG No data
Right 952693885 3:36243013-36243035 GAGAATCCCTGTGCCCACAGGGG No data
952693879_952693883 15 Left 952693879 3:36242973-36242995 CCTGAGCCAAAGAGAGCACACAG No data
Right 952693883 3:36243011-36243033 GGGAGAATCCCTGTGCCCACAGG No data
952693879_952693882 -5 Left 952693879 3:36242973-36242995 CCTGAGCCAAAGAGAGCACACAG No data
Right 952693882 3:36242991-36243013 CACAGCATTTGAGTGACTGTGGG No data
952693879_952693881 -6 Left 952693879 3:36242973-36242995 CCTGAGCCAAAGAGAGCACACAG No data
Right 952693881 3:36242990-36243012 ACACAGCATTTGAGTGACTGTGG No data
952693879_952693884 16 Left 952693879 3:36242973-36242995 CCTGAGCCAAAGAGAGCACACAG No data
Right 952693884 3:36243012-36243034 GGAGAATCCCTGTGCCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952693879 Original CRISPR CTGTGTGCTCTCTTTGGCTC AGG (reversed) Intergenic
No off target data available for this crispr