ID: 952693880

View in Genome Browser
Species Human (GRCh38)
Location 3:36242979-36243001
Sequence CAAATGCTGTGTGCTCTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952693880_952693885 11 Left 952693880 3:36242979-36243001 CCAAAGAGAGCACACAGCATTTG No data
Right 952693885 3:36243013-36243035 GAGAATCCCTGTGCCCACAGGGG No data
952693880_952693883 9 Left 952693880 3:36242979-36243001 CCAAAGAGAGCACACAGCATTTG No data
Right 952693883 3:36243011-36243033 GGGAGAATCCCTGTGCCCACAGG No data
952693880_952693884 10 Left 952693880 3:36242979-36243001 CCAAAGAGAGCACACAGCATTTG No data
Right 952693884 3:36243012-36243034 GGAGAATCCCTGTGCCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952693880 Original CRISPR CAAATGCTGTGTGCTCTCTT TGG (reversed) Intergenic
No off target data available for this crispr