ID: 952693885

View in Genome Browser
Species Human (GRCh38)
Location 3:36243013-36243035
Sequence GAGAATCCCTGTGCCCACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952693879_952693885 17 Left 952693879 3:36242973-36242995 CCTGAGCCAAAGAGAGCACACAG No data
Right 952693885 3:36243013-36243035 GAGAATCCCTGTGCCCACAGGGG No data
952693880_952693885 11 Left 952693880 3:36242979-36243001 CCAAAGAGAGCACACAGCATTTG No data
Right 952693885 3:36243013-36243035 GAGAATCCCTGTGCCCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952693885 Original CRISPR GAGAATCCCTGTGCCCACAG GGG Intergenic
No off target data available for this crispr