ID: 952694440

View in Genome Browser
Species Human (GRCh38)
Location 3:36249351-36249373
Sequence CAGGGGCACACATCAGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952694432_952694440 19 Left 952694432 3:36249309-36249331 CCCTTGTGCACTTCAAGGGAGGA No data
Right 952694440 3:36249351-36249373 CAGGGGCACACATCAGAAGGAGG No data
952694433_952694440 18 Left 952694433 3:36249310-36249332 CCTTGTGCACTTCAAGGGAGGAA No data
Right 952694440 3:36249351-36249373 CAGGGGCACACATCAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952694440 Original CRISPR CAGGGGCACACATCAGAAGG AGG Intergenic
No off target data available for this crispr