ID: 952701781

View in Genome Browser
Species Human (GRCh38)
Location 3:36336182-36336204
Sequence TCCCCACTAGAACTGTAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952701776_952701781 13 Left 952701776 3:36336146-36336168 CCAATGAGTAAGGGAATCAGATG No data
Right 952701781 3:36336182-36336204 TCCCCACTAGAACTGTAAAGTGG No data
952701775_952701781 19 Left 952701775 3:36336140-36336162 CCTAGGCCAATGAGTAAGGGAAT No data
Right 952701781 3:36336182-36336204 TCCCCACTAGAACTGTAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952701781 Original CRISPR TCCCCACTAGAACTGTAAAG TGG Intergenic
No off target data available for this crispr