ID: 952708289

View in Genome Browser
Species Human (GRCh38)
Location 3:36402287-36402309
Sequence ATGGAGGGGAAGAAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3938
Summary {0: 1, 1: 2, 2: 31, 3: 422, 4: 3482}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952708282_952708289 20 Left 952708282 3:36402244-36402266 CCAAATCCTGGTATAATGATAAT 0: 1
1: 0
2: 0
3: 11
4: 174
Right 952708289 3:36402287-36402309 ATGGAGGGGAAGAAGAAGGAAGG 0: 1
1: 2
2: 31
3: 422
4: 3482
952708283_952708289 14 Left 952708283 3:36402250-36402272 CCTGGTATAATGATAATAATAAA 0: 1
1: 0
2: 6
3: 100
4: 707
Right 952708289 3:36402287-36402309 ATGGAGGGGAAGAAGAAGGAAGG 0: 1
1: 2
2: 31
3: 422
4: 3482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952708289 Original CRISPR ATGGAGGGGAAGAAGAAGGA AGG Intronic
Too many off-targets to display for this crispr