ID: 952711788

View in Genome Browser
Species Human (GRCh38)
Location 3:36439101-36439123
Sequence CAGTGGAAAGAGCATGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 671
Summary {0: 1, 1: 1, 2: 6, 3: 55, 4: 608}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952711778_952711788 -5 Left 952711778 3:36439083-36439105 CCCCTAAAGACCCACCAGCAGTG 0: 1
1: 0
2: 0
3: 6
4: 134
Right 952711788 3:36439101-36439123 CAGTGGAAAGAGCATGGGGACGG 0: 1
1: 1
2: 6
3: 55
4: 608
952711776_952711788 3 Left 952711776 3:36439075-36439097 CCATCCATCCCCTAAAGACCCAC 0: 1
1: 0
2: 3
3: 22
4: 228
Right 952711788 3:36439101-36439123 CAGTGGAAAGAGCATGGGGACGG 0: 1
1: 1
2: 6
3: 55
4: 608
952711779_952711788 -6 Left 952711779 3:36439084-36439106 CCCTAAAGACCCACCAGCAGTGG 0: 1
1: 0
2: 1
3: 11
4: 134
Right 952711788 3:36439101-36439123 CAGTGGAAAGAGCATGGGGACGG 0: 1
1: 1
2: 6
3: 55
4: 608
952711774_952711788 11 Left 952711774 3:36439067-36439089 CCACTCCTCCATCCATCCCCTAA 0: 1
1: 0
2: 10
3: 100
4: 969
Right 952711788 3:36439101-36439123 CAGTGGAAAGAGCATGGGGACGG 0: 1
1: 1
2: 6
3: 55
4: 608
952711775_952711788 6 Left 952711775 3:36439072-36439094 CCTCCATCCATCCCCTAAAGACC 0: 1
1: 0
2: 2
3: 21
4: 238
Right 952711788 3:36439101-36439123 CAGTGGAAAGAGCATGGGGACGG 0: 1
1: 1
2: 6
3: 55
4: 608
952711781_952711788 -7 Left 952711781 3:36439085-36439107 CCTAAAGACCCACCAGCAGTGGA 0: 1
1: 1
2: 0
3: 35
4: 288
Right 952711788 3:36439101-36439123 CAGTGGAAAGAGCATGGGGACGG 0: 1
1: 1
2: 6
3: 55
4: 608
952711777_952711788 -1 Left 952711777 3:36439079-36439101 CCATCCCCTAAAGACCCACCAGC 0: 1
1: 0
2: 0
3: 17
4: 240
Right 952711788 3:36439101-36439123 CAGTGGAAAGAGCATGGGGACGG 0: 1
1: 1
2: 6
3: 55
4: 608
952711773_952711788 14 Left 952711773 3:36439064-36439086 CCTCCACTCCTCCATCCATCCCC 0: 1
1: 3
2: 9
3: 191
4: 1667
Right 952711788 3:36439101-36439123 CAGTGGAAAGAGCATGGGGACGG 0: 1
1: 1
2: 6
3: 55
4: 608

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952711788 Original CRISPR CAGTGGAAAGAGCATGGGGA CGG Intronic
900639555 1:3682180-3682202 CAGTGGAGAGGGCACAGGGAGGG + Intronic
901376574 1:8843852-8843874 AATTGGAAAGAGAATGGGGAAGG - Intergenic
902408462 1:16199299-16199321 CAGGGGGAGGAGCATGGGTAGGG + Intronic
902418058 1:16254139-16254161 TCGTGGAAAGAGCAGAGGGAGGG - Intronic
902451872 1:16501407-16501429 TAGAGGAAAGAGCATGGGATTGG - Intergenic
902501080 1:16912257-16912279 GAGAGGAAAGAGCATGGGATTGG + Intronic
902760589 1:18578318-18578340 CTGTGGAAAGACCCTGGGGCAGG + Intergenic
902806663 1:18865391-18865413 CACAGGTATGAGCATGGGGACGG - Intronic
903222889 1:21878675-21878697 AAGTGGACAGGGCATGGGGCAGG + Intronic
903383730 1:22913632-22913654 CAGTGGATAGAGCACCAGGAGGG - Exonic
903790576 1:25890210-25890232 CAGAAGAAGGAGCTTGGGGAAGG + Intronic
904012554 1:27398189-27398211 CAGGGGAAGAAGGATGGGGAGGG + Intergenic
904322344 1:29706099-29706121 CAGGGGAAAGATGATGGGAAGGG - Intergenic
904795832 1:33055699-33055721 TAGGGGAAAGGGCATGGAGAGGG - Intronic
904921573 1:34012223-34012245 CAGCGGGAAGAGCAAGGGCAAGG - Intronic
905228063 1:36492869-36492891 CTGTGGCAGGAGGATGGGGATGG + Intergenic
905280180 1:36844115-36844137 CAGTGGATCAAGCATGGGGCAGG - Intronic
905482009 1:38268237-38268259 CAGAGGAAAGGGCATCTGGAAGG + Intergenic
905699154 1:39999064-39999086 CCGTGGAAAGGGGAGGGGGAGGG - Intergenic
906139411 1:43524855-43524877 AGGTGTAAAGAGAATGGGGAGGG + Intergenic
906553767 1:46690223-46690245 CAGTGGGAAGGGAATGGGAAAGG - Intronic
906660187 1:47576400-47576422 CTGTGGAAGCAGCATGGGGCTGG + Intergenic
906724668 1:48035578-48035600 CAAAGGAAAGAGCAGGGGGAGGG + Intergenic
907629848 1:56069526-56069548 CAGTGGAAAGAGCAGGAGCAAGG + Intergenic
907913297 1:58846101-58846123 CAGAGGAAACAGCATGGGGAAGG - Intergenic
908329729 1:63059284-63059306 CAGTAGAAAGAGCATGAGTTTGG - Intergenic
908573044 1:65429232-65429254 CAATGAGAAGATCATGGGGAAGG + Intronic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910074281 1:83259088-83259110 CAAGGGAAAGACCTTGGGGAGGG - Intergenic
910722197 1:90298734-90298756 GTGTGGAAAGAGCATGGGTTTGG + Intergenic
912500524 1:110119099-110119121 CAGTGGAAAGAATATAAGGAGGG - Intergenic
913185213 1:116364478-116364500 CAGTGGAAAGAGAAGGGGCTGGG + Intergenic
915022991 1:152798488-152798510 TGGTGGACAGAGGATGGGGAAGG + Intronic
915432900 1:155880407-155880429 CAGTGGGAAGAGTCTGGGGGAGG - Intronic
916060740 1:161097084-161097106 CAGAGAACACAGCATGGGGATGG - Intergenic
916080532 1:161229319-161229341 CAGCCACAAGAGCATGGGGAAGG - Exonic
916207336 1:162328091-162328113 CTGTGGAAAGAGCATGGGCTTGG - Intronic
916501599 1:165392372-165392394 CAGTGGAAGGAGCAGGGGACAGG - Intergenic
917836016 1:178942119-178942141 CGGGGGAAACAGGATGGGGAAGG - Intergenic
918141477 1:181723797-181723819 CAGAGGGAAAGGCATGGGGATGG + Intronic
918460308 1:184769730-184769752 AAGTGGAAAGAGAAAGAGGAAGG + Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919579601 1:199355293-199355315 CAGTGGAGAGAGCAGTGGGAAGG - Intergenic
919920671 1:202164797-202164819 CAGAGGAGAGAGCAAGGGGCAGG - Intergenic
920229973 1:204463780-204463802 CTGTGGAAAGAGCTTGGAGCTGG - Intronic
920445794 1:206015299-206015321 CAGTTGCCAGAGCCTGGGGAGGG - Intronic
920679006 1:208058714-208058736 CTGTGAAAGGAGCCTGGGGAGGG - Intronic
921034083 1:211359720-211359742 CTGAGGAGAGGGCATGGGGAGGG - Intronic
921051225 1:211513246-211513268 CTGTGGAAAGAGCACTGGGTTGG - Intergenic
921114459 1:212074979-212075001 CAGAGAAAAGAGGATGGGGTGGG - Intronic
922453082 1:225752277-225752299 CAGGGGGAAGAAAATGGGGAGGG - Intergenic
922718700 1:227889542-227889564 GAGTGGCTGGAGCATGGGGAGGG - Intergenic
922720762 1:227899200-227899222 GAGTGGCCAGAGCAGGGGGAGGG + Intergenic
922882346 1:228990419-228990441 GAGTGGAAAGGCCATGGGAAGGG + Intergenic
923051618 1:230394504-230394526 GAGTGAAAGGAGCTTGGGGATGG - Intronic
923097641 1:230788308-230788330 CAGTGGAAAGAGCTAGGATAGGG - Intronic
923339659 1:232996498-232996520 CAGAGTAAACAGCATGGGGTGGG + Intronic
923438150 1:233988583-233988605 GGATGGAAAGAGCATGTGGAGGG - Intronic
924501648 1:244643925-244643947 CCATGGACAGGGCATGGGGAAGG - Intergenic
924798420 1:247309655-247309677 GAGTGGACAGAGTAGGGGGAAGG - Intronic
1062992377 10:1832593-1832615 CAGTGCAAAGACCCTGGGGCAGG + Intergenic
1063123050 10:3118068-3118090 CATTGGTGAGAGCATGGGGGAGG + Intronic
1063769363 10:9180317-9180339 AAGCGGAATGAACATGGGGAAGG + Intergenic
1064010140 10:11729146-11729168 CAGAGGGAAGAGCAAGGGGTTGG - Intergenic
1064555599 10:16544307-16544329 CAGTGGAAAGAGCAGGGGTGGGG - Intergenic
1064642133 10:17425932-17425954 CTGTGGAAAAAGAGTGGGGATGG - Intronic
1065664973 10:28049430-28049452 CAGTGGAAACAGCGTGGAGCTGG + Intergenic
1066334558 10:34462987-34463009 GGGAGGAAAGAGAATGGGGAGGG + Intronic
1066474110 10:35727984-35728006 CAAAGGAAATAACATGGGGAAGG + Intergenic
1066628136 10:37430757-37430779 CAGTGGAAACAGCAAGGGTGAGG + Intergenic
1066676445 10:37892794-37892816 CACTGGAAATAGAAAGGGGAAGG - Intergenic
1067683717 10:48455314-48455336 CAGTGGATAGAGCTGGGGCAGGG + Intronic
1068922686 10:62501306-62501328 CAGAGGGAAGAGCATGTGCAAGG - Intronic
1068934821 10:62625332-62625354 CAGTGGGAAGAGCACTGGAAAGG - Intronic
1068935516 10:62632217-62632239 CAGTGGAAAGAGCAGGGGCTGGG - Intronic
1069838805 10:71326597-71326619 CAGTGGACAGAGGAGGGGCAGGG - Intronic
1069902932 10:71716212-71716234 CAGGGCGATGAGCATGGGGAGGG + Exonic
1069994508 10:72334303-72334325 CAGTGGGAAGGGCTGGGGGAGGG - Exonic
1070567458 10:77614728-77614750 AGGTGGAAAGGGCATGGGGTTGG - Intronic
1070729214 10:78813768-78813790 CAGGGGAGAGAGGAAGGGGAAGG - Intergenic
1071270435 10:84001799-84001821 GAGTGGAAGGGGCATGGAGAAGG - Intergenic
1072350972 10:94556613-94556635 CTGTGGATAGAACATGGGGTAGG - Intronic
1072640791 10:97209660-97209682 CAGTGAAAAGAGCACTGGGCAGG + Intronic
1073502142 10:103949870-103949892 CAGTGGAAGGGGCAGGGGAAAGG + Intergenic
1074764559 10:116691198-116691220 CAGGGGAAGCAGCCTGGGGAAGG + Intronic
1075181619 10:120216027-120216049 CCGTGGAAAGGGGAGGGGGAGGG + Intergenic
1076229587 10:128808985-128809007 CAGTGGGTGGAGCAGGGGGAAGG - Intergenic
1076682390 10:132179895-132179917 CAGGGGGAAGAGCATGGGAGGGG - Intronic
1076802198 10:132835916-132835938 CAGGGGCAGGAGCAGGGGGAGGG - Intronic
1077192577 11:1261622-1261644 AGGTGGACAGAGCATGGGGATGG - Exonic
1077727078 11:4685233-4685255 CAGTGGGAAGCCCATGGGAATGG - Intronic
1077866258 11:6224022-6224044 CAATGGGATGAGCTTGGGGATGG - Exonic
1078007261 11:7541286-7541308 CAGTGCAGAGTGAATGGGGAGGG + Intronic
1078423040 11:11228114-11228136 CAGTAGAAAGAACATGGAGGAGG - Intergenic
1078668993 11:13348414-13348436 CAGTGGAGAGGGGATGGGGCTGG + Intronic
1079299190 11:19262406-19262428 CAGATGAAAGAACATGGAGAGGG + Intergenic
1079396166 11:20065706-20065728 CAGTGGCAGAGGCATGGGGAAGG + Intronic
1079456835 11:20643636-20643658 CAGTGGAAAGAGCACTGGACTGG - Intronic
1079459198 11:20665263-20665285 AAGTGCAAAGATCATGAGGATGG + Intergenic
1079501254 11:21103829-21103851 CCGTTGAAAGAGACTGGGGAAGG - Intronic
1080470778 11:32543381-32543403 GGGTGGGAAGAGAATGGGGAGGG + Intergenic
1080612843 11:33919812-33919834 CAGTAGAAAGAGGAAGGGGAGGG - Intergenic
1082616232 11:55363270-55363292 CCCTGGAAAGATCATGTGGAAGG + Intergenic
1082674154 11:56075112-56075134 CTGTGGCAGGAGGATGGGGAGGG - Intergenic
1082774039 11:57232335-57232357 CAGTGGAGAGTGAATGGGGATGG - Intergenic
1082877589 11:58003571-58003593 GGGTGGACAGAGCAGGGGGAAGG + Intergenic
1082999329 11:59277304-59277326 TAGTGGAAAGAACATAGAGATGG + Intergenic
1083402450 11:62433304-62433326 AAGAGGAAAGAGAAAGGGGAGGG + Intergenic
1083647957 11:64184067-64184089 CAGTGCAAAGGGCCTGGGGTGGG - Intergenic
1083869416 11:65477681-65477703 CAGTGCAGAGATCCTGGGGAGGG - Intergenic
1083951383 11:65958506-65958528 CAAGGGAAAGAGGATGGGGAGGG + Intronic
1084911773 11:72395389-72395411 CAGTGGAAAGAGCAAGGGTTTGG + Intronic
1085016127 11:73175098-73175120 AAGAGGAAAGAGCAAGGAGAAGG + Intergenic
1085341913 11:75737334-75737356 GAGTGGAAAGAGCACTGGGTGGG - Intergenic
1085474138 11:76778948-76778970 CAGGGGAAAAAGCATGGAGGTGG + Intergenic
1085571099 11:77558683-77558705 CAGTGGGCAGAGCAGGGTGAAGG - Intronic
1086066879 11:82754958-82754980 CAGTGGAAAGAGTGTGAAGATGG - Intergenic
1086133604 11:83424717-83424739 TAGTTGAAAGTGCAGGGGGAGGG + Intergenic
1086560580 11:88163940-88163962 CAGTGGATAAAGCAGGGGGAAGG + Intronic
1087225693 11:95595882-95595904 TGGTGGAAAGAGCATTGGCAAGG - Intergenic
1087246013 11:95838053-95838075 CAGTAGAGATAGTATGGGGAAGG + Intronic
1087625593 11:100592511-100592533 CAGAGGAAAGAACATGCAGAAGG + Intergenic
1088187764 11:107192574-107192596 CAGAGAAAAGAGGATGGGTATGG - Intergenic
1088324322 11:108586502-108586524 GGGAGGAAAGAGGATGGGGAGGG - Intronic
1088324370 11:108586606-108586628 GGGAGGAAAGAGGATGGGGAGGG - Intronic
1088651510 11:111961329-111961351 GAGTGGAAAGAGCATTGGCTTGG + Intronic
1089224046 11:116900633-116900655 GAGAGGAAATAGCATGTGGAAGG - Intronic
1089494534 11:118901618-118901640 CATGGGACAGAGCATGGAGATGG - Exonic
1089879595 11:121760925-121760947 GAGTGGGCAGAGCATGGGGCAGG + Intergenic
1089884540 11:121806928-121806950 CTGAGCGAAGAGCATGGGGATGG + Intergenic
1090578250 11:128132324-128132346 CATTGCTAAGAGCCTGGGGATGG - Intergenic
1090699770 11:129283086-129283108 CAGGAGAAAGATCACGGGGAGGG - Intergenic
1090924200 11:131235425-131235447 CAGTGGAAAGCACACGGGGTAGG - Intergenic
1091032629 11:132204668-132204690 CTGTGGGAAGAGCATGGAGAGGG + Intronic
1091071551 11:132569036-132569058 CAGTGGGAAAGGCATGGGGCAGG + Intronic
1091672983 12:2466552-2466574 CAGTGGAAAAAGCAAGGGATGGG - Intronic
1091692287 12:2605426-2605448 CAGTGGAAGGAATATAGGGATGG - Intronic
1091988769 12:4937456-4937478 CAGTGGGAACAGCATGTGGTGGG + Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093878545 12:24377636-24377658 CAGTGGAAGGAGCACGAGGCTGG - Intergenic
1094555751 12:31497918-31497940 CAGGGGCAAGGGCAGGGGGAGGG + Intronic
1095747296 12:45674027-45674049 CAGTGTCAAGAGCATAGGCATGG - Intergenic
1095981383 12:47976653-47976675 AAGTGGAAAGGGAATGGGGCTGG - Intronic
1097029906 12:56082671-56082693 CAGAGGAAAGAGACTGGGGTAGG + Intronic
1097070008 12:56347851-56347873 TGGTGGAAAGAGCATGGGCTTGG + Intronic
1097122959 12:56750073-56750095 CAGTGGAAACAGCTTGAGCAAGG + Intronic
1097185133 12:57192685-57192707 CAGTGGGGAGGGCATGGGGATGG - Intronic
1097234878 12:57532537-57532559 GAGTGGAAAGGAGATGGGGAAGG + Intronic
1097384640 12:58934754-58934776 GAGTGGGAAGAGCAGGAGGAGGG - Intergenic
1098141751 12:67457121-67457143 CAGTGGCAAGAGAATGGCAAGGG - Intergenic
1098190671 12:67945191-67945213 CTGAGGAAGGAGCATGGGAAGGG + Intergenic
1098957398 12:76701919-76701941 CAGTGGAGTGTGCATGGTGAGGG - Intergenic
1099074048 12:78082837-78082859 CAGTGAAAAGAACAAAGGGAAGG - Intronic
1099877515 12:88427414-88427436 CAGAGGCAGGAGTATGGGGAAGG + Intergenic
1099968415 12:89475412-89475434 CAGTGACCAGAGCAGGGGGAAGG - Intronic
1100107632 12:91196182-91196204 CAGTCAAAAGAGCTTGGGCAGGG + Intergenic
1100591946 12:96037500-96037522 CAGTGGGGTGAGAATGGGGAAGG + Intronic
1101042680 12:100772499-100772521 TAGTGGAGTGAGCATGGGGCAGG + Intronic
1101365177 12:104064397-104064419 CAGTGGAGAGACGCTGGGGAAGG - Intergenic
1101676433 12:106921220-106921242 CACTGGAAAGAGAATGAAGAGGG - Intergenic
1101759473 12:107646915-107646937 CAGTGGACAGAAGAAGGGGAGGG + Intronic
1102862386 12:116347834-116347856 CAGTGAAAAGAGACAGGGGAGGG - Intergenic
1103101063 12:118176250-118176272 ATGTGGAAAGACCTTGGGGAAGG + Intronic
1103185261 12:118951319-118951341 CAGTAGACAGAGCATGAGGGTGG - Intergenic
1103978626 12:124720987-124721009 CTGTGGAAGGAACAAGGGGAGGG + Intergenic
1103986261 12:124769550-124769572 ACGGGGAAAGGGCATGGGGAAGG - Intergenic
1104551032 12:129757559-129757581 GAGTGGAAAGATCATGGGGCTGG - Intronic
1104891617 12:132142940-132142962 CGGTGGAAAAAGCTAGGGGAGGG + Intronic
1107024327 13:35784446-35784468 CATTGGAAAGAACATGGGAATGG - Intronic
1107796307 13:44055628-44055650 GAGTGGAAAGAGGAAGGGGATGG + Intergenic
1107817997 13:44261530-44261552 CTGTGGAAAGAGCCTTTGGAGGG + Intergenic
1107855107 13:44607404-44607426 AAGTGGAAAAGGGATGGGGATGG - Intergenic
1109704594 13:66073379-66073401 CAGGGAAAAGAGGATGGAGATGG + Intergenic
1110218947 13:73052554-73052576 AAGTGGAAGGAGGGTGGGGATGG - Intergenic
1111758529 13:92431574-92431596 CAGTGTAAAGAAGATGGAGATGG + Intronic
1112198513 13:97250993-97251015 CAGTGGAAATAGCAATGGCAAGG - Intronic
1112712825 13:102150086-102150108 CAGTGGAAAGAGCATTGATCAGG + Intronic
1113164989 13:107430438-107430460 GAGTGGAGGGAGCAGGGGGAGGG - Intronic
1113225919 13:108159463-108159485 CAGTGGCAAGAGCCTTGGGTTGG - Intergenic
1113618042 13:111694924-111694946 CAGTGGAGAGAGGAGAGGGAGGG - Intergenic
1113618055 13:111694983-111695005 CAGTGGAGAGAGGAGAGGGACGG - Intergenic
1113623575 13:111780185-111780207 CAGTGGAGAGAGGAGAGGGAGGG - Intergenic
1113623588 13:111780244-111780266 CAGTGGAGAGAGGAGAGGGACGG - Intergenic
1113681121 13:112245822-112245844 CAGTGGAAAGAGGAAGGGAAAGG + Intergenic
1113808576 13:113123827-113123849 CAGGGGACAGAGGCTGGGGAGGG - Intronic
1114786353 14:25604262-25604284 CAATGGAAAGACCATGTTGAGGG + Intergenic
1115732528 14:36286795-36286817 CGGTGGGAAGAGCAGGTGGATGG - Intergenic
1116435276 14:44888818-44888840 CAGTGCAAAGAGCATCACGATGG - Intergenic
1117442698 14:55774838-55774860 CAGTGGGGAGAGGATGAGGAGGG - Intergenic
1117647812 14:57870738-57870760 CAATGGACAGAGCAGGGGCAGGG - Intronic
1118779270 14:68995791-68995813 TAGAGGAAAGAGAATTGGGAGGG - Intergenic
1119172317 14:72544757-72544779 CAGGGGAAGGAACAGGGGGATGG - Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1120332334 14:83109507-83109529 CAGTGGCAGGATAATGGGGAAGG + Intergenic
1120701850 14:87706729-87706751 GAGTGGAAAGAGCATTGGATTGG - Intergenic
1120754888 14:88233502-88233524 CTGGGGACAAAGCATGGGGAAGG + Intronic
1120923170 14:89773204-89773226 AAGGGGAAAGAGCACGTGGAGGG + Intergenic
1121174684 14:91882393-91882415 CAGTGGGTGGAGCATGGGGCTGG + Intronic
1121231975 14:92364961-92364983 CAGTGGAAAGGGCAGGGGCAAGG - Intronic
1121263080 14:92580742-92580764 AGGGGGAAAGAGCATGGAGAAGG + Intronic
1121414609 14:93770484-93770506 CAGAGGAAACAGCATGTGCAAGG - Intronic
1121900768 14:97691533-97691555 TAAAGGAAAGACCATGGGGAAGG + Intergenic
1122117512 14:99535244-99535266 CAGTGGGAAAAGCAGGGAGAGGG + Intronic
1122196033 14:100086553-100086575 TACTGGAAAGGGCATGGGAAGGG + Intronic
1122237445 14:100339940-100339962 CCGTGGGAAAAGCCTGGGGAGGG - Intronic
1122375175 14:101252495-101252517 CAGTGGCAAGAGCAAAGGCACGG - Intergenic
1122500110 14:102191739-102191761 CACTGGAAAGGGATTGGGGAGGG + Intronic
1122652398 14:103232709-103232731 CAGTGGGAGCAGCAGGGGGATGG + Intergenic
1122825965 14:104370605-104370627 CTGTGGAAAGAGCGTGAAGACGG - Intergenic
1123116596 14:105897585-105897607 CTGTGGGAAGAGCACAGGGAAGG - Intergenic
1124425656 15:29560507-29560529 CAGTGGACACAGCAAGGGCAGGG - Intronic
1125457744 15:39877862-39877884 TAATGGAAAGAGCATGGAGTTGG - Intronic
1126416514 15:48423405-48423427 CAGTGGAAAGAGCACAGGACAGG - Intronic
1126504805 15:49392362-49392384 CAGTGGAATGTGCATGGGGAAGG + Intronic
1126504922 15:49393923-49393945 TAGTGGAATGTGCATGGGGAAGG + Intronic
1126689028 15:51273546-51273568 CAGAGGAAAGAGCACTGGAATGG + Intronic
1126782463 15:52150417-52150439 AAATGGACAGAGAATGGGGAGGG - Intronic
1126835876 15:52664585-52664607 CAGTGGAAAGAACATGGGTTTGG - Intronic
1126867745 15:52954702-52954724 CTCTGGAAAGAGACTGGGGAAGG - Intergenic
1126902383 15:53327472-53327494 CATTGGAGAGAGAATGGGGTGGG + Intergenic
1126936622 15:53716639-53716661 CAATGGACAGTGCATGGAGAAGG - Exonic
1127278922 15:57472230-57472252 CAGAGGAAATAGCATGTGCAAGG + Intronic
1127315207 15:57788473-57788495 CACTGGGCAGAGCTTGGGGATGG + Intergenic
1127390350 15:58500155-58500177 GGGTGGAAAGAGCATGGGTTTGG + Intronic
1127538936 15:59918035-59918057 CAAGGGAAAGCGCACGGGGAGGG + Intergenic
1129139148 15:73581383-73581405 AAGTGGCAAGAGCAAGGGGTAGG + Intronic
1129672114 15:77613241-77613263 CAGTGGAGAGAGCCAGGGGCTGG - Exonic
1129696674 15:77744160-77744182 CAGAGGAAAGAGCATAGGTTTGG + Intronic
1129746750 15:78027241-78027263 GACTGGAAAGGGCACGGGGATGG + Intronic
1130223681 15:82043090-82043112 CTGGGGAAAGAGGGTGGGGAGGG + Exonic
1130271687 15:82454170-82454192 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130464035 15:84181557-84181579 CAATGGAAAGAGCAGGAGAAGGG + Intronic
1130474836 15:84255487-84255509 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130482252 15:84369543-84369565 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130488649 15:84413276-84413298 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1130500232 15:84491984-84492006 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1130507787 15:84562463-84562485 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1130586331 15:85186189-85186211 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1131132922 15:89911786-89911808 CAGGGGATAGTGGATGGGGATGG - Intronic
1131432937 15:92401131-92401153 CAGTGGAAACGGCCGGGGGAGGG + Intronic
1131538851 15:93259435-93259457 CAGTGTATACAGCATTGGGATGG - Intergenic
1131947077 15:97635278-97635300 CAGGGGAAAGAGCATCTGAAAGG - Intergenic
1131979256 15:97979623-97979645 CAGTAGAAAGAACGAGGGGAAGG - Intergenic
1132066107 15:98732551-98732573 CTATGGAGTGAGCATGGGGAAGG + Intronic
1132428119 15:101737776-101737798 CAATGGAAAGAGCAGGAGAAGGG - Intronic
1132519077 16:379131-379153 CAGTGGACACAGCAGGGGGCGGG + Intronic
1133493520 16:6295012-6295034 TAGTGGAAAAAGCATGGTCACGG - Intronic
1133747620 16:8699216-8699238 CAGAGGGAAGAGATTGGGGAGGG + Intronic
1133756987 16:8769269-8769291 CAGTTGAAAGAATATGGGGCTGG + Intronic
1133865313 16:9636713-9636735 CAGGGGAGAGAGAAAGGGGAGGG + Intergenic
1134173984 16:11991264-11991286 CAGTGGCTAGAGCATCGGGAAGG - Intronic
1134264721 16:12683363-12683385 GAATGGACAGAGCCTGGGGAAGG - Intronic
1135183081 16:20291920-20291942 CAGGGGAGAGAGGAGGGGGAGGG + Intergenic
1135250545 16:20898058-20898080 TAGTGGAAAGAGGATGGGTTGGG - Intronic
1135420769 16:22304255-22304277 CAGTGGGAAGGGCAGGGGCAAGG + Intronic
1135792736 16:25412424-25412446 CAGTTGAAAGAGGTTGTGGAGGG - Intergenic
1136077045 16:27824339-27824361 CTGTGGAAAGAGCAGGGGTTTGG - Intronic
1137029379 16:35507331-35507353 CTGTGGAAAGAGCCTGGGTGAGG - Intergenic
1138353878 16:56362514-56362536 CAGTGGGAAGAGTGTGGGGGAGG - Exonic
1138396533 16:56708976-56708998 CACTGGCAACAGCAGGGGGATGG + Intronic
1138964873 16:62072091-62072113 CAGTGGAAGAAGCTGGGGGAAGG - Intergenic
1139265929 16:65638229-65638251 GTGTGGAAAAAGCACGGGGAAGG + Intergenic
1139549290 16:67664589-67664611 CAGTGGGAAGGGCAGGGGTATGG - Intronic
1140072454 16:71663030-71663052 CACTGCACAGAGCCTGGGGATGG - Intronic
1141163987 16:81648037-81648059 CGGTGGAAGCAGCAGGGGGAGGG - Intronic
1141509084 16:84501135-84501157 CAGAGACAAGGGCATGGGGATGG + Intronic
1142721233 17:1777276-1777298 GAGTGGAACGAGGATGGGGCGGG + Exonic
1143161403 17:4874035-4874057 TGGTGGAAAGAGCATGGGAGAGG - Intronic
1144807804 17:17979173-17979195 CAGTGCAAAGGGCCTGGGGCAGG + Intronic
1146449753 17:32963590-32963612 AAGTGGAAAGAACTTGGGCAGGG - Intergenic
1146554770 17:33813923-33813945 CAGTGGAGGGAGAATGAGGAAGG + Intronic
1147112958 17:38277451-38277473 CAGAGGAAGGAGAATGGGGTGGG - Intergenic
1147326370 17:39671653-39671675 CAGAGGAAGGAAAATGGGGATGG - Exonic
1148159787 17:45443440-45443462 CCATGGAAACAGCATGGGGCAGG - Intronic
1148416663 17:47511774-47511796 CAGAGGAAGGAGAATGGGGTGGG + Intergenic
1149331247 17:55584505-55584527 CAGTAGAAAGAGCATGGACCTGG + Intergenic
1149599729 17:57885611-57885633 CGGCGGAAAGACCCTGGGGAAGG - Exonic
1149779443 17:59385641-59385663 AAGTGGTAAGAGGATGAGGAGGG + Intronic
1150129964 17:62663765-62663787 CAGTGCAAGGGGCAGGGGGAAGG + Intronic
1150391075 17:64790312-64790334 CCATGGAAACAGCATGGGGCAGG - Intergenic
1150409856 17:64934364-64934386 CCTTGGAAACAGCATGGGGCAGG - Intergenic
1150652005 17:67016436-67016458 TGGAGGAAAGAGCTTGGGGACGG + Intronic
1151107897 17:71639334-71639356 CAGTGGGAAGAGCAAGGAAAAGG + Intergenic
1152168856 17:78729889-78729911 CTGTGGAAAGAGAGTGGGGGAGG + Intronic
1154385783 18:13890742-13890764 CGTTGGATAAAGCATGGGGAGGG - Intronic
1155326163 18:24666963-24666985 GAGAGGAAAGAGAAAGGGGAAGG - Intergenic
1155364739 18:25038672-25038694 TAGTGGAAAGAACAGGGGGCTGG + Intergenic
1155895437 18:31319508-31319530 CACTGAAAAGAGCATGGGATAGG - Intronic
1156232898 18:35172230-35172252 CAGTGGCAGGAGCATGGGCTTGG - Intergenic
1156325071 18:36067498-36067520 CCGTGGTGAGAGCGTGGGGAAGG - Exonic
1156561374 18:38129603-38129625 CAGTGAGAAGAGAAAGGGGAAGG - Intergenic
1156608986 18:38703971-38703993 AAGTGGAAAGGGGATGGGGAAGG - Intergenic
1158262414 18:55622715-55622737 GTGTGGAAAGAGCATCTGGATGG - Intronic
1158973367 18:62688658-62688680 TTGGGGAAAGAGCATGGGGGTGG + Intergenic
1159002577 18:62987331-62987353 CAGTCGTACGCGCATGGGGAAGG + Intergenic
1159664398 18:71140298-71140320 CAGTGTAAGGAGCATTGAGAAGG - Intergenic
1160394509 18:78562113-78562135 CAGTGGGAAGGGCAGAGGGATGG - Intergenic
1160843334 19:1156032-1156054 CGGTGGACGGAGCTTGGGGAGGG + Intronic
1161331757 19:3691959-3691981 CAGGGAAAAGAGCCTGGGGTGGG - Intronic
1163545051 19:17936387-17936409 CTGCGGGAAGAGGATGGGGATGG - Intronic
1163690232 19:18734778-18734800 CAGTGGCAACACCCTGGGGAGGG + Intronic
1163741821 19:19018971-19018993 CAGTGAGAAGAGCATGAGGGTGG - Intronic
1163779630 19:19239632-19239654 GAGTGGAAGGAGGAGGGGGAGGG - Intronic
1164434605 19:28218741-28218763 CAGAGGAGCGAGCATGGGAAAGG + Intergenic
1164473144 19:28552523-28552545 AAGAGGAAAGAGCTTGCGGAAGG - Intergenic
1164868152 19:31622148-31622170 CATTGGAAAGAGAGAGGGGATGG + Intergenic
1164991429 19:32687345-32687367 CAGTGGCATGATCTTGGGGAAGG - Intergenic
1165096323 19:33411748-33411770 CACTGCAAAGAGCCGGGGGAGGG + Exonic
1165177219 19:33939179-33939201 GAGAGGGAAGAACATGGGGAGGG - Intergenic
1165363936 19:35352465-35352487 CGGGGGAAGGAGCATGGGGCAGG + Exonic
1166121937 19:40691512-40691534 CAGAGAAAAGAGCTGGGGGAAGG + Exonic
1166410772 19:42554329-42554351 CAGTAGAAAGGGGCTGGGGAGGG + Intronic
1166632196 19:44416414-44416436 CAGTGTTAAGAGCATGGGGCTGG - Intergenic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167173391 19:47848827-47848849 CAGAGGAAACAGCTGGGGGAAGG - Intergenic
1167612451 19:50514001-50514023 AAGTGGACAGAGCACAGGGAAGG - Intronic
1168696409 19:58406332-58406354 CCGTGGAAAGAGCGGGGGGGGGG + Intronic
925251880 2:2445637-2445659 CATTAGAAAGATCATGGGCATGG - Intergenic
925797912 2:7566802-7566824 CAGAGGGAAGAGCATGTGCAAGG - Intergenic
926289028 2:11514038-11514060 CAGTGCAGAGAGGATGGGGATGG + Intergenic
926305789 2:11636729-11636751 CAGGGGTAAGGGCATGGGCATGG + Intronic
926321215 2:11749445-11749467 CTGTGGAAAGAGGAAGAGGAAGG - Intronic
926835616 2:17016239-17016261 CAGTGGAAAGGGGATTGTGAAGG + Intergenic
926888364 2:17618020-17618042 CCGGGGAAAGAATATGGGGAGGG + Intronic
927433540 2:23047581-23047603 AAGTGGAAAGGGCCTGGGGAAGG + Intergenic
928024507 2:27728707-27728729 CATTGGAAGGAGTAGGGGGATGG - Intergenic
928312185 2:30220256-30220278 CAGTGGGAAGACCATGGGCCTGG - Intergenic
928366963 2:30710217-30710239 CAATGGAAAGAGCATGGCTTTGG + Intergenic
928692496 2:33815279-33815301 CACCGGAAGGAGCAAGGGGAAGG + Intergenic
929092565 2:38233983-38234005 CAGTGGAGGGAGGCTGGGGAGGG - Intergenic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
929441030 2:41965907-41965929 CAGAGGAGAGAGAGTGGGGATGG + Intergenic
930731908 2:54735973-54735995 AGGTGGAAAAAGAATGGGGAAGG + Intronic
932299487 2:70656064-70656086 CAGTGGAAAGAGCCAGGGCTTGG + Intronic
934045525 2:88170277-88170299 CAGTGGGAAGGACCTGGGGATGG - Intronic
934557566 2:95295518-95295540 CAGTGAAAGGAGGATGGGGCTGG + Intergenic
935243094 2:101194857-101194879 CTGTGGGAAGAGGATGGGGCTGG - Intronic
936060616 2:109293470-109293492 CAGTGGAGAGAGAAGGGGGCAGG - Intronic
936293514 2:111247388-111247410 TAGTGGAAAGAGCATTGGACAGG + Intergenic
936513632 2:113168084-113168106 CAGCAGAAAGTGCATTGGGAAGG + Intronic
936768025 2:115877162-115877184 GAGTGAAAAGAGCAAGGGGAGGG - Intergenic
937506614 2:122544583-122544605 CAGTGGAAAAAACATGAGCAAGG - Intergenic
937747961 2:125437680-125437702 AAGTGGATAGATCATGGAGAAGG + Intergenic
938194091 2:129310883-129310905 CATTGGAAAGAGCACAGAGAGGG + Intergenic
938377586 2:130818967-130818989 GAGAGGAGAGTGCATGGGGAAGG + Intergenic
938678311 2:133661739-133661761 CAGGGGAAAGGGCTTGGGTATGG - Intergenic
940775015 2:157876091-157876113 CGGGGGAAAGAGCCGGGGGAGGG + Intergenic
940788531 2:158007335-158007357 GAGTGGAAAGAGCTTGGGCTTGG - Intronic
941237949 2:162998512-162998534 TAGTTGCCAGAGCATGGGGAAGG - Intergenic
941584667 2:167342684-167342706 CAGAGGAACAAGGATGGGGAGGG - Intergenic
941645993 2:168042137-168042159 GAGTGGAAAGAGAATTGGGCAGG - Intronic
941739838 2:169023806-169023828 AAGTGGAATGAGACTGGGGAGGG + Intronic
942126884 2:172835443-172835465 CAGTGGAAAGCACATGGGCATGG + Intronic
942749585 2:179272770-179272792 GAGTGGAAGGAGCCTGGGCATGG - Intergenic
944415492 2:199475590-199475612 CAGTGGAGAGGGGCTGGGGAGGG - Intergenic
944638629 2:201699179-201699201 CAGTGGGGAGAGCATTTGGAAGG + Intergenic
944860158 2:203808241-203808263 CAGTGGGAAGAGCCAGGGGTGGG + Intergenic
945131243 2:206575050-206575072 AAGTGGAAAGAGTATAGGGTAGG + Intronic
946233080 2:218304666-218304688 CAGTGGAAAGAGCATGGAATTGG + Intronic
946360348 2:219215965-219215987 CAGTGGAAAGGGCATGTGGGAGG - Intronic
947767513 2:232647175-232647197 CAGTGGAAAGAACACTGGGCTGG - Intronic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
1168801118 20:643707-643729 CAGTTGAAAGAGCAGGGTGATGG + Intergenic
1168836568 20:881561-881583 CAGAGGACAGGGCATGGGGAGGG + Intronic
1170356318 20:15495939-15495961 AAGAGGAAAGAGCATGAGCAAGG + Intronic
1170456347 20:16537271-16537293 CCGTGGGAAGAGGATGGGGCAGG - Intronic
1171347879 20:24479515-24479537 CAGAGGAAGGGGCATGGGAAGGG - Intronic
1171365124 20:24617933-24617955 GAGTGGGGAGAGCCTGGGGAGGG + Intronic
1171782320 20:29430605-29430627 CTGCGGCAAGAGCAAGGGGACGG - Intergenic
1171938816 20:31304142-31304164 ATGTGGAAAGTGCATGGTGAAGG - Intronic
1171983074 20:31640510-31640532 GAGTGGGAACTGCATGGGGAAGG + Intronic
1172027047 20:31955614-31955636 CAGTGGAAAGACCCTGAGGCAGG - Intergenic
1172324898 20:34026729-34026751 CAGAGAAAAGAGGATGGGAAAGG - Intronic
1172484649 20:35291053-35291075 CAGGAGAAAGAGAATTGGGAGGG - Intronic
1172896626 20:38304754-38304776 CAGTGGGGAGAGCACGGGGTGGG - Intronic
1172944318 20:38675533-38675555 CAGTGGGTAGGGTATGGGGATGG - Intergenic
1173940850 20:46909963-46909985 CATGGGGAAGAGCATGTGGAGGG - Intronic
1173957035 20:47041264-47041286 TAAAGGAAAGAGCATGGGGAGGG - Intronic
1175051655 20:56161135-56161157 CAGAGGAAAGAGCAAGTGCAAGG - Intergenic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175160735 20:57005754-57005776 CAGTGGAAAGACCTTGGAGCCGG - Intergenic
1175225536 20:57441874-57441896 CAGAGGAATGGGCAGGGGGAGGG + Intergenic
1175247441 20:57590409-57590431 CTCTGGAAGGAACATGGGGAAGG - Intergenic
1175363740 20:58435915-58435937 TAGTGAAAAGAGCATGGGCTTGG + Intronic
1175937058 20:62518739-62518761 CACCGGAAAGAGGATGGGGTGGG + Intergenic
1176122174 20:63458845-63458867 CAGCGGGAAGAGCAAGGCGAGGG + Intronic
1176343357 21:5718400-5718422 TAGGGGGAAGGGCATGGGGAAGG - Intergenic
1176501470 21:7606056-7606078 TAGGGGGAAGGGCATGGGGAAGG + Intergenic
1176537678 21:8116469-8116491 TAGGGGGAAGGGCATGGGGAAGG - Intergenic
1177659499 21:24064427-24064449 CAGTGGTAGGAGCATAGGGGAGG + Intergenic
1179079469 21:38157418-38157440 CAGTGCATAGAGCTTTGGGAGGG + Intronic
1180082601 21:45493623-45493645 CTGTGGAGACAGCCTGGGGAGGG + Intronic
1180638441 22:17279109-17279131 CAGTGCAAAGAGCAAGGGAAGGG - Intergenic
1181097746 22:20517508-20517530 CAGTGAAAAGAGCAGGGTGGTGG - Intronic
1181116402 22:20634844-20634866 CTGTGGAAAGAGGCTGGGGGTGG - Intergenic
1181471959 22:23145975-23145997 CAGTGGAAGTAGAGTGGGGAGGG - Intronic
1181665389 22:24392124-24392146 CAGTGGAAAGAGCCTGGGGCTGG - Intronic
1182044545 22:27264100-27264122 CAGAGGAGACAGCATGTGGAAGG + Intergenic
1182107912 22:27702388-27702410 CAGTGGAAAGGGCAATGGGTTGG + Intergenic
1182370106 22:29804776-29804798 CAGTCGAGAGTGCATGGGAAGGG - Exonic
1182733296 22:32512475-32512497 TAGGGGAAAGAGCACTGGGAAGG + Intergenic
1182764369 22:32748035-32748057 CAGTGAAAAGAGCTTGGTGTTGG + Intronic
1183650492 22:39150879-39150901 CAGTGGAGACAGCATGGGAGAGG - Intronic
1183670172 22:39268239-39268261 CAGAGGAAGGAGCGTGGGCATGG - Intergenic
1183713204 22:39519061-39519083 CAGTGGAGGGAGTATGGGGTAGG - Intergenic
1183731781 22:39622413-39622435 GAGTGTAAAGGGCTTGGGGAGGG + Intronic
1183742269 22:39675380-39675402 CAGGGGTCAGAGCATGGGGAAGG - Intronic
1183986272 22:41572195-41572217 GAGTTGGAAGAGGATGGGGATGG - Intronic
1184272881 22:43394873-43394895 AAGTGGGAAGAGCCTGGTGAGGG - Intergenic
1184551931 22:45209205-45209227 CAGCGGGATGGGCATGGGGAGGG + Intronic
1184723723 22:46331092-46331114 GAGTGGAAAGAGGATGGGCGAGG + Intronic
1185402300 22:50625452-50625474 CTGTGGGCAGAGCCTGGGGAGGG + Exonic
1203242624 22_KI270733v1_random:32824-32846 TAGGGGGAAGGGCATGGGGAAGG - Intergenic
949146187 3:702299-702321 CAGTGCAAACAGCATGTGGAAGG - Intergenic
949258541 3:2079488-2079510 CAGTGGAAAGGGGACGGGGTGGG - Intergenic
949809520 3:7991465-7991487 CAGTGGAAATAGGATCTGGAAGG - Intergenic
949973721 3:9434821-9434843 TAGGGGAATGAGCAGGGGGAAGG + Exonic
950398991 3:12756037-12756059 CATTGGAAAGAGCAATGGAAAGG + Intronic
951632944 3:24741021-24741043 CATTGGTAAGAGCCTGGGAAAGG + Intergenic
951865521 3:27302781-27302803 CCCTGCAATGAGCATGGGGAAGG + Intronic
952362107 3:32641058-32641080 CAGTGGGAAGAGGATGGAAAGGG + Intergenic
952711788 3:36439101-36439123 CAGTGGAAAGAGCATGGGGACGG + Intronic
953038307 3:39232720-39232742 CAGTGGAAAGAGCATGGACTTGG + Intergenic
954594681 3:51814397-51814419 CCATGGAAAGAGCCTGCGGAGGG - Intergenic
954905856 3:54062267-54062289 CAGGGGAAATGGCATGGGGGGGG - Intergenic
955079027 3:55640617-55640639 CTGTGGTAAGGGCATGAGGAAGG + Intronic
955317030 3:57947779-57947801 CAGTGGGAACAGCATGTGCAAGG + Intergenic
955756822 3:62233352-62233374 CTGGGGAGAGAGCATGGGGAAGG - Intronic
955787727 3:62557572-62557594 CAGAGGAGAGAACATGGGGGAGG - Intronic
955819082 3:62876243-62876265 AAGTGAAAGGAGCACGGGGAAGG - Intergenic
956952401 3:74297475-74297497 GAGTGGAAAGAGGAAGGGTATGG + Intronic
957236465 3:77598797-77598819 CAGTCGACATAGCAGGGGGAGGG - Intronic
957382945 3:79457702-79457724 CAGGTGAAAGAGCATGTGCAGGG - Intronic
959650410 3:108745377-108745399 CACAGGAATGAGCATGGGGGAGG + Intronic
959710950 3:109385234-109385256 AAGTGAAAAGAGCATGGGCTTGG + Intergenic
960195277 3:114759298-114759320 CAGTGGAAAGGGGATGGGGAGGG + Intronic
961084109 3:124051875-124051897 AAGTGGAAAGAGCAGTGGGCTGG + Intergenic
961178577 3:124857496-124857518 CAGTGGAAAGATCATGGATCTGG - Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961520992 3:127467312-127467334 CAGAAGAAAGTGCCTGGGGATGG - Intergenic
961640943 3:128364527-128364549 CAGTGGAAAGACCATGGGATGGG + Intronic
961786609 3:129351102-129351124 CAGAGGAAACAGCATGAGCAAGG - Intergenic
961809592 3:129514252-129514274 CAGAGGAAAGACCGTGAGGAAGG - Intronic
962306048 3:134287285-134287307 CAGTGCAATGAGCAGGGGGATGG - Intergenic
963324974 3:143852338-143852360 CAGTGGAAAGAACATGGAGTTGG - Intergenic
963702675 3:148645692-148645714 GAGTCAAAAGAGCATGTGGAAGG - Intergenic
963709464 3:148730272-148730294 CAGTGGGAAGAGCATAGTGATGG - Intronic
963771750 3:149393296-149393318 CAGAGGAAGTAGCATGGGAAAGG - Intergenic
963860816 3:150308511-150308533 CAGTGGCGAGAGCCTGGCGAAGG + Intergenic
963884627 3:150567529-150567551 CAGTGGAAAAAGCATGGGGTAGG - Intronic
964421861 3:156511696-156511718 AAGTAGAAAGAGCTTGAGGAAGG - Intronic
964676560 3:159288869-159288891 CGGTGTATGGAGCATGGGGAGGG - Intronic
964749623 3:160042323-160042345 CAGTGGAATGGGAGTGGGGAGGG + Intergenic
966949165 3:184800651-184800673 TAGAGGAAAGAGGCTGGGGAAGG - Intergenic
967279825 3:187811130-187811152 CAGTGGAAATAGCAAGGCCAAGG + Intergenic
967945326 3:194799432-194799454 TAGTGGAAAGAGCATGGCCCGGG - Intergenic
968449694 4:669342-669364 TAGTGGGAATAGCATGGGGTAGG - Intronic
968449723 4:669434-669456 TAGTGGGAATAGCATGGGGTAGG - Intronic
968844032 4:3029816-3029838 CAGTGGCAGGAGCATGGGGAAGG - Intronic
968962392 4:3752252-3752274 CAGTGGAGTGTGCATGAGGAAGG - Intergenic
969294523 4:6262012-6262034 CAGGGAACTGAGCATGGGGAGGG - Intergenic
969477271 4:7428702-7428724 GAGAGGAAAGAACAAGGGGAGGG + Intronic
970140561 4:12977500-12977522 CAGAGGAAAGACCATGTGGTTGG - Intergenic
970294393 4:14613259-14613281 AAGTGGAAAGGACATAGGGAAGG - Intergenic
970311149 4:14783844-14783866 CTGTGGAAAGAGCAGTGGTATGG - Intergenic
970846234 4:20541357-20541379 CAGCGGAAATAGCGTGGAGAAGG + Intronic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971628362 4:28954808-28954830 CAGTGGACAGAGAGTGTGGAGGG - Intergenic
973634819 4:52852150-52852172 CAGTGGAAAGATGAAAGGGAAGG - Intergenic
973644946 4:52940887-52940909 CAGTGGAAAGAGCGTGCCCAAGG - Intronic
973759281 4:54101607-54101629 CAATGGCAAGAGGATGAGGACGG + Exonic
974140339 4:57878575-57878597 GATTGGGAGGAGCATGGGGAAGG + Intergenic
975673744 4:76806628-76806650 CAGTGGAAAGACCAAGATGAAGG + Intergenic
976569781 4:86594618-86594640 CTGTAGAAGGAGCCTGGGGAGGG - Exonic
976987274 4:91317434-91317456 AAGGTGAAAGAGAATGGGGAGGG - Intronic
977931914 4:102758869-102758891 CAGTGGAATGAGAAATGGGAAGG - Intronic
978360162 4:107923267-107923289 GAGTGGAAAGAGGAAGGGAAAGG - Intergenic
978376818 4:108082625-108082647 GAGTGGAGAGAGCATGGGAGTGG + Intronic
978732359 4:112043719-112043741 CAGTGGAAAGAACATTGGATTGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
981562159 4:146059687-146059709 CAGTGCAAAGAGCCTGGGGTGGG - Intergenic
981878537 4:149578931-149578953 GAGAGGCAAAAGCATGGGGAAGG - Intergenic
983286489 4:165746270-165746292 CAGTACAAAGAGCATGAAGATGG + Intergenic
984565435 4:181324481-181324503 CAGTGGAAATTGCAGGGGCAGGG - Intergenic
985448373 4:190041129-190041151 CTGCGGCAAGAGCAGGGGGACGG - Intergenic
986105291 5:4653981-4654003 CTGTGGAAGCAGCTTGGGGATGG - Intergenic
986573515 5:9189539-9189561 CACTGGACAAAGAATGGGGAGGG + Intronic
986581329 5:9269376-9269398 CAGTAGAAAGACAATGGAGATGG + Intronic
988291905 5:29297971-29297993 CAGAGACAAGAGCATGGGAATGG + Intergenic
988845161 5:35120119-35120141 CAGTGGGTAGAGCATGGAGATGG + Intronic
989661715 5:43806264-43806286 AAGAGGAATGAACATGGGGAGGG + Intergenic
990226087 5:53656047-53656069 CAGTGCAAGGAGCCTGGAGACGG - Intronic
990486133 5:56260832-56260854 CAGTGGCAATAGTTTGGGGAAGG + Intergenic
990742532 5:58926708-58926730 CAGGGGAAAGAGGAAGGGCAGGG + Intergenic
990816354 5:59790001-59790023 CATTGGAGAGAGTTTGGGGAGGG + Intronic
991274267 5:64825214-64825236 CAATGGAAAGAGCTGTGGGAGGG + Intronic
991943878 5:71881446-71881468 CAGTGGAAAGTCTTTGGGGAAGG - Intergenic
992421760 5:76613267-76613289 CAGTGGAAACATCAAGGTGAAGG - Intronic
993813154 5:92508637-92508659 CAGGAGCAAGAGCATGAGGAGGG - Intergenic
995241124 5:109885989-109886011 GAGTGGAGAGACGATGGGGATGG + Intergenic
995508281 5:112882832-112882854 CAATTGAGAGAGGATGGGGAAGG - Intronic
995806909 5:116063557-116063579 CAGAGTAAAGAGCATGCTGAAGG + Intergenic
996051126 5:118935020-118935042 CACTGGAAAGACTAAGGGGAAGG + Intronic
996069242 5:119116051-119116073 CAATGGCAAGAACTTGGGGATGG - Intronic
996641149 5:125755221-125755243 CAGTGAAAAGAGCATTAGAAAGG + Intergenic
996709673 5:126531948-126531970 CAGTGGAGAGAGCCCTGGGAAGG + Intergenic
997565467 5:134882825-134882847 CCGTGGAAAGAGGAGGGAGAGGG + Intronic
997722477 5:136090423-136090445 CAGTAGGAACAGCATGGTGAAGG + Intergenic
998128763 5:139640689-139640711 CAGTGGACAGGGCTGGGGGATGG + Intergenic
999378789 5:151105460-151105482 CAGAGGAGGAAGCATGGGGAAGG - Intronic
999681004 5:154060016-154060038 CAGAGGAAAGAGCAATGGCAAGG + Intronic
1000017569 5:157291344-157291366 CAGTGGAAAGAGCCCTGGGTGGG - Intronic
1000060780 5:157653105-157653127 CAGTAGAAAGAGAATGATGATGG - Intronic
1000065786 5:157691934-157691956 CAGTAGAAAGAGAATGATGATGG - Intergenic
1000113872 5:158135215-158135237 CAGGAGAAAGGGGATGGGGAAGG + Intergenic
1000381372 5:160632447-160632469 GGGTGGTAAGAGCATGGGAAGGG + Intronic
1000537132 5:162493126-162493148 CAGGAGAAATAGCATGGGAATGG + Intergenic
1001099672 5:168803948-168803970 AAGTGGGAAGACCATGGGTAGGG + Intronic
1001226255 5:169946911-169946933 CAGAGGGAAGAGCGTGGGCAAGG + Intronic
1001586524 5:172836598-172836620 CGGAGGAAGGTGCATGGGGATGG - Intronic
1001869578 5:175139407-175139429 GAGTGCACAGAGTATGGGGAAGG + Intergenic
1002201027 5:177528376-177528398 GAGAGGAAAGAGGCTGGGGAGGG + Intronic
1003487533 6:6592507-6592529 CAGTGGAAGAAGCAGGGTGAGGG + Intronic
1003717282 6:8661477-8661499 CAGTGGAATGAGCAGGGTCAGGG + Intergenic
1003904456 6:10686392-10686414 AAGTGGGAAGGGAATGGGGAAGG + Intronic
1005093806 6:22088516-22088538 CAGTGGAAAGAGTTTGGGGCTGG + Intergenic
1005279163 6:24252622-24252644 AAGTAGAAAGAGAATGGTGAGGG + Intronic
1005529678 6:26690133-26690155 GAGTGCAAAGATCATGAGGAAGG - Intergenic
1005541118 6:26811514-26811536 GAGTGCAAAGATCATGAGGAAGG + Intergenic
1005763267 6:28987029-28987051 CAGGAGAAAGAGCAGGGGGGCGG + Intergenic
1005921528 6:30406213-30406235 CAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1005972291 6:30770889-30770911 CAGTGGAAAGAGCCCTGGGCTGG - Intergenic
1006025329 6:31143174-31143196 GTGTGGAAAGAGGATGGTGAGGG - Intronic
1006438951 6:34041430-34041452 CAGTGAGAAGCCCATGGGGATGG - Intronic
1007431151 6:41778058-41778080 CCGTGGGAGGGGCATGGGGAAGG + Exonic
1007600485 6:43077729-43077751 CAATGGGAAGGGCATGGGTAAGG + Intronic
1007778755 6:44238958-44238980 CAGTGGAAAGTGCAGGGGGCAGG - Intergenic
1008621910 6:53279036-53279058 AAGGGGAAAGAGCATGGGTTTGG + Intronic
1008829704 6:55742982-55743004 CAGTGAAAAGAACACGGAGATGG - Intergenic
1009011930 6:57853599-57853621 GAGTGCAAAGATCATGAGGAAGG + Intergenic
1010048322 6:71473403-71473425 CAGGGAAAAGAGCTTGGAGATGG - Intergenic
1011213608 6:84981226-84981248 AAGAGTAAAGAGCATGGAGAAGG + Intergenic
1012268709 6:97180432-97180454 CAGGGTAGAGAGGATGGGGATGG + Intronic
1012627963 6:101427306-101427328 CAGAGCAATGAGAATGGGGATGG - Intronic
1012685542 6:102243487-102243509 GTGTGGAAAGAGAATGGAGAAGG - Intergenic
1013005790 6:106072377-106072399 CAGTGGAGAGAGGACAGGGAAGG - Intergenic
1013048339 6:106509742-106509764 GAATGGAAGGAGCATGGGGTGGG + Intergenic
1013619008 6:111871742-111871764 CAGGGGAAAGAACGAGGGGATGG + Intronic
1014642070 6:123924605-123924627 CAGTAGAAAGAGAACAGGGATGG + Intronic
1014743698 6:125174829-125174851 GAGTGCAAAGTGCATGGGGAAGG + Intronic
1015471628 6:133612758-133612780 CAGAGAAAGGAGCATGGAGAGGG - Intergenic
1015471633 6:133612785-133612807 CAGAGGAAGGAGCATGCAGAGGG - Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017616859 6:156255202-156255224 CAGTGGAAATAAAATGGGGGAGG - Intergenic
1018167375 6:161110897-161110919 CAGTGGACAGAGACTGAGGATGG - Intronic
1018362806 6:163088518-163088540 CAGTGGGAAGTGCAGGGGGTCGG - Intronic
1018928200 6:168221854-168221876 CCGTGGAAAGAGCATGGACCTGG + Intergenic
1018964373 6:168473155-168473177 CAGTGGACAGAGCAGGGAGTGGG + Intronic
1019257522 7:61660-61682 CAGTGGAAAGGACTCGGGGACGG - Intergenic
1019484234 7:1281323-1281345 CAGAGGAAAAAGCGTGGGAACGG + Intergenic
1020402346 7:7793399-7793421 TAGTGGAAAGAACAGGGGAATGG - Intronic
1021428698 7:20534678-20534700 CTTTGGAAAGTGCATGTGGATGG + Intergenic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022113364 7:27244352-27244374 GGGTGGAAAGAGCCTGGGGGCGG + Intronic
1022152040 7:27618161-27618183 AAGTGTACAGAGCAGGGGGAAGG - Intronic
1023155074 7:37242071-37242093 GAGAGGAAAAAGAATGGGGAAGG - Intronic
1023485087 7:40677721-40677743 CAGTCAAAAGAGAATGGGGTTGG + Intronic
1024110838 7:46145008-46145030 CAGTGGAAAGAAGATGGGAAAGG + Intergenic
1024244328 7:47457751-47457773 CAGTTGAAGGACCATGGGAAAGG + Intronic
1024382568 7:48715246-48715268 GAGAGTAAAGAGAATGGGGAAGG - Intergenic
1024684795 7:51733711-51733733 CAGGGAAGAGAGCATGTGGAGGG + Intergenic
1026474908 7:70726900-70726922 GAGAGGAAAGAGAATGAGGAAGG - Intronic
1027208498 7:76123887-76123909 CTGTGGAAGAAGCATGGAGACGG - Intergenic
1027291978 7:76723950-76723972 CAAGGGAAAGACCTTGGGGAGGG - Intergenic
1027333461 7:77123279-77123301 CGGTGGAAAGAGCAGGGACAAGG + Intronic
1027406444 7:77866519-77866541 CAGTGGAAAGGGCATGGAATTGG + Intronic
1027965435 7:84999675-84999697 CAGAGGGCAGAGCATGAGGAGGG - Exonic
1029576893 7:101409335-101409357 AAGTGGATGGAGCATGGGGTTGG + Intronic
1029782334 7:102748032-102748054 CGGTGGAAAGAGCAGGGACAAGG - Intergenic
1029866862 7:103641458-103641480 CAATGGAAAGATCTTGGTGATGG + Intronic
1029994043 7:104989174-104989196 CAATGGACAGGGCAAGGGGATGG + Intergenic
1030503272 7:110386548-110386570 CAGGGGAAATAGGATGGAGAGGG + Intergenic
1030568130 7:111186719-111186741 AAGTGGAAAGAGGCTGGGCACGG - Intronic
1031137552 7:117901295-117901317 CAGTAGAAAGATCAGAGGGATGG + Intergenic
1031400874 7:121325336-121325358 CAGTGGAAAGAGCACTGGGTTGG - Intergenic
1031878845 7:127173383-127173405 CAGAGCAAAGGTCATGGGGAAGG + Intronic
1031938992 7:127767219-127767241 CAGTGGAAAGGGATGGGGGAAGG - Intronic
1032073024 7:128821370-128821392 CAGAGTCAAGAGGATGGGGAAGG - Intronic
1032583909 7:133129173-133129195 CTGGGGAAAGGGCATGTGGATGG + Intergenic
1032655834 7:133928749-133928771 CATTAGAAAGAGGAAGGGGATGG + Intronic
1033461453 7:141550893-141550915 CAGGGGAGAGAGCCTGGAGAGGG - Intergenic
1034998230 7:155591773-155591795 CTATGGAGAGAGCTTGGGGAAGG - Intergenic
1036052719 8:5217954-5217976 CAGTGACTAGAGCATGGGGTTGG - Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036656376 8:10679870-10679892 GAGTGGAGAGAGAAAGGGGACGG - Intronic
1037241892 8:16786683-16786705 CCGTGGACAGGGGATGGGGATGG - Intergenic
1037260342 8:17001436-17001458 CAGTGGGAAGGGCAAGGGGAAGG + Intronic
1037476501 8:19262922-19262944 CAGTGCAAAGGCCCTGGGGAAGG - Intergenic
1037569724 8:20148062-20148084 CAGAGGAACCTGCATGGGGAAGG + Exonic
1037823641 8:22147868-22147890 CAGGGGGCAGAGCATGGGAAAGG + Exonic
1038052492 8:23826947-23826969 GACTGGAAAGAGCCAGGGGATGG + Intergenic
1038074504 8:24056782-24056804 CAATGGAAATAGCCTTGGGAGGG + Intergenic
1038395828 8:27244736-27244758 AAGTGGAAAGAGGAGGGGGCGGG + Intronic
1039965296 8:42279705-42279727 CAATGGAAAAAGCATGAGGTTGG - Intronic
1041193253 8:55374635-55374657 CAACAGGAAGAGCATGGGGATGG + Intronic
1041550319 8:59092957-59092979 TAGTGGAAAGAGCATTGGACAGG + Intronic
1042362935 8:67903083-67903105 CAGTGGAAGGAGCAAGGGTTTGG - Intergenic
1042505783 8:69558344-69558366 CAGTTGAAACAGCAGGGGCAGGG - Intronic
1042816471 8:72882969-72882991 AAGTGGAAAGGGCCTGGAGAAGG - Intronic
1043368765 8:79566161-79566183 CAGTGGAAAGAACAAGAGCAAGG - Intergenic
1044323488 8:90832825-90832847 CAATGGAAAGAGCTTGGGTTTGG - Intronic
1047016129 8:120725151-120725173 AAGTGGAAAGAGGATGGGCGAGG + Intronic
1047255807 8:123212690-123212712 CAGGGGAAAGAGAATGGTGCTGG + Intergenic
1048294020 8:133201024-133201046 GAGGGGAAAGGGCATGGGGTTGG - Intronic
1048616088 8:136076893-136076915 AGGTGGAAAGGGGATGGGGAGGG + Intergenic
1048670799 8:136717319-136717341 CAGAGGAAAGAGTCTGGGAATGG + Intergenic
1048948841 8:139476054-139476076 TGGTGGGAAGAGCTTGGGGAGGG + Intergenic
1049195388 8:141312928-141312950 CAGAGGAGAGAGCCAGGGGAGGG - Intergenic
1049340757 8:142111447-142111469 AAGATGAAAGAGCATCGGGAGGG + Intergenic
1050779259 9:9310409-9310431 CAGTGAAGAGAGAATGGGTAAGG - Intronic
1051487463 9:17624452-17624474 ACATGGAAAGAGCATGGAGATGG - Intronic
1051501792 9:17786082-17786104 CAGTGAAGGGAGGATGGGGAAGG + Intronic
1051606712 9:18923906-18923928 CAGTGGTTGGAGGATGGGGAAGG - Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052078559 9:24175116-24175138 CAGTGGAAAGAGCATGGAATTGG + Intergenic
1052300326 9:26946699-26946721 AAGTGGAAAGAGCACAGGGTTGG - Intronic
1052467174 9:28843599-28843621 CAGTGAACAGAGAAAGGGGAGGG + Intergenic
1052918204 9:33940000-33940022 GAGGGGAAAGAGGAGGGGGAGGG + Intronic
1053223198 9:36328323-36328345 CTGTGGAAGGAGCATGGGAGTGG + Intergenic
1055410750 9:76026929-76026951 CAGAGGAGAGAGCAAGGGAAAGG - Intronic
1055919646 9:81445796-81445818 CAGAGGAAAGAGTATGGGGGAGG - Intergenic
1056267861 9:84917396-84917418 CAGTGGAAGGAGCACTGGGCCGG + Intronic
1056439306 9:86604364-86604386 CAGGAGCAAGACCATGGGGATGG + Intergenic
1056791145 9:89626094-89626116 CAGTGGAAAATGCCTGGAGAAGG - Intergenic
1057554377 9:96076013-96076035 CAGTGGAAAAGGCAACGGGAAGG - Intergenic
1057854671 9:98593428-98593450 CAATGGCAGGAGCAGGGGGAAGG + Intronic
1058536249 9:105963331-105963353 CAGTGAAAAGAGCAAGGGTTTGG - Intergenic
1058637324 9:107049285-107049307 CAGTGGACAGTGCAGGAGGAGGG - Intergenic
1059341732 9:113601212-113601234 CAGTGGGAAGAGTTTGGGGAGGG - Intergenic
1059550468 9:115223975-115223997 CCATGGATAGACCATGGGGAAGG - Intronic
1059708419 9:116845085-116845107 CAGTGGAGAGAGCAGGGGCCTGG - Intronic
1059927039 9:119219915-119219937 CAGCGGGAAGAGCATGGAAAAGG + Intronic
1060288776 9:122280633-122280655 TAATGGAAAGAGCATGGGTTTGG + Intronic
1060670171 9:125461819-125461841 GAGTGGACAGAGCCTGAGGAAGG + Intronic
1060741729 9:126103201-126103223 CAGAGGAGAGAGCAGGTGGAAGG - Intergenic
1061513253 9:131073449-131073471 CAGTGTCACCAGCATGGGGAGGG + Intronic
1062537522 9:137027513-137027535 CAGTGGCGAGAGCATGAGCAAGG + Exonic
1203768183 EBV:37235-37257 CCGGGGACAGAGCAGGGGGAGGG + Intergenic
1203458950 Un_GL000220v1:15907-15929 TAGGGGGAAGGGCATGGGGAAGG - Intergenic
1185989429 X:4876462-4876484 CAGTGGAAAGAGGAAGAGGGTGG + Intergenic
1186637480 X:11422029-11422051 CAGTGGAAAGACAGTGGGAAAGG + Intronic
1188244685 X:27825340-27825362 CAGTGGGAAGACCCAGGGGAAGG - Intergenic
1188409903 X:29858978-29859000 CAGAGGAAAGAGCTTTGGTAAGG - Intronic
1190116787 X:47630453-47630475 AAGTGGCAGGAGCCTGGGGAGGG + Intergenic
1190311768 X:49122075-49122097 AAGTGGAATGAGTAAGGGGAAGG - Intronic
1190333296 X:49248585-49248607 CAGTGAGCAGAGCATAGGGATGG - Intronic
1190681467 X:52830351-52830373 TGGAGGAAAGAGCAGGGGGAGGG - Intergenic
1191901377 X:66044093-66044115 CAGTGGAAAGAGCATGGGAATGG + Intergenic
1192359549 X:70430503-70430525 CAGTCTAATGAGCAAGGGGAAGG + Intronic
1195245151 X:102988645-102988667 CAGAAGCAAGAGCATGGGGAAGG - Intergenic
1196807734 X:119603910-119603932 CAGTGGAAAGAGCATCAGTCTGG + Intronic
1197646142 X:129019073-129019095 CAGAGGAGAGAGGATGGTGAGGG - Intergenic
1197798381 X:130322418-130322440 CAGGGGAAAGAGGAAGGGGTTGG - Intergenic
1198103935 X:133445013-133445035 TAGTGGAAAAAGCATGGCGCTGG + Intergenic
1199539750 X:148945847-148945869 CAATGGGAAGAGCATAGGGTTGG - Intronic
1200137806 X:153883425-153883447 CAGAGGAGAGAGCAGGGGGGCGG + Intronic
1201705845 Y:16935848-16935870 CAGTGTAAAGAGCTTGCAGAAGG - Intergenic
1202371177 Y:24197080-24197102 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1202376150 Y:24239389-24239411 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1202494630 Y:25430729-25430751 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1202499607 Y:25473037-25473059 CAATGGAAAGAGCAGGAGAAGGG + Intergenic