ID: 952711944

View in Genome Browser
Species Human (GRCh38)
Location 3:36440358-36440380
Sequence CAATTTGACAAGGACTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952711940_952711944 13 Left 952711940 3:36440322-36440344 CCAGTCATCTTTTTAGTTGAAGA 0: 1
1: 0
2: 1
3: 24
4: 306
Right 952711944 3:36440358-36440380 CAATTTGACAAGGACTCAGCTGG 0: 1
1: 0
2: 0
3: 33
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952711944 Original CRISPR CAATTTGACAAGGACTCAGC TGG Intronic
900890960 1:5449364-5449386 CAGTGTGAGAAGGACGCAGCTGG + Intergenic
902849853 1:19146356-19146378 CAATTTGACAATGACAAAACAGG + Intronic
904154603 1:28472266-28472288 CAAACTGGCATGGACTCAGCTGG - Intronic
904276093 1:29385233-29385255 GAATTTGAGAAGGGCTCAGCTGG + Intergenic
906185971 1:43862357-43862379 AAATTAGACAAGGTCTCAGGAGG - Intronic
906832561 1:49048545-49048567 CTATTTGAGGAGGGCTCAGCAGG + Intronic
907659756 1:56381197-56381219 CAATTTGACAAGAGATCAGAAGG + Intergenic
907964717 1:59317998-59318020 CCATTTGTCAAGGACTCTGCTGG - Intronic
908943941 1:69471371-69471393 CAACTTGAGAAGGACTCCACAGG - Intergenic
909154828 1:72060671-72060693 CAATTTGAGTAGTACTCAGCAGG + Intronic
918067330 1:181110170-181110192 CCATTTGATAAGGGCTCTGCGGG + Intergenic
919986258 1:202677638-202677660 CAGTTTGAGCAGGGCTCAGCTGG - Intronic
920665723 1:207961494-207961516 CAATGTGAGAAAGACTCGGCTGG - Intergenic
921448687 1:215276982-215277004 TATTTTGAAAAGGACTCAGATGG + Intergenic
921548968 1:216509812-216509834 TAATTAGACAATGATTCAGCTGG + Intronic
922333532 1:224599181-224599203 CAATATGAAATGGGCTCAGCTGG + Intronic
1064369499 10:14738916-14738938 GAATTTGGAAAGGACTCAGCTGG + Intronic
1065469612 10:26064178-26064200 CTAATTGACAAGGGCTCACCAGG + Intronic
1068272104 10:54741752-54741774 CAAATTGAGAAAGACTCAGGTGG - Intronic
1069906535 10:71735619-71735641 TAATGTGACAGGGACTCAGCAGG - Intronic
1071096464 10:81981236-81981258 CAATTTTACAAGTTCACAGCTGG - Intronic
1073553179 10:104422494-104422516 CAATTTGAGCTGGGCTCAGCTGG + Intronic
1078622044 11:12917206-12917228 CAATGTGAGAAGGATTCGGCTGG + Intronic
1079144734 11:17840590-17840612 CACTTTGAACAGGGCTCAGCTGG - Intronic
1079314029 11:19392357-19392379 CAATTTGAGCAGGGCTCAGCAGG + Intronic
1079789591 11:24719514-24719536 CAATGTAACAAGTACTCAACTGG + Intronic
1080247419 11:30195458-30195480 GAATTTGAAAAGGGCACAGCAGG - Intergenic
1080482472 11:32666243-32666265 CAAGTTGAAAACCACTCAGCAGG - Intronic
1081612413 11:44570547-44570569 CACTTTGCCAAGGAGTCACCTGG - Intronic
1084095237 11:66907013-66907035 CATTTTGTGAAGGACTGAGCCGG + Intronic
1084469063 11:69344610-69344632 AAATCTGACAAGGAGTGAGCAGG - Intronic
1088124338 11:106405259-106405281 CAATGTGATAAAGACTCAGCTGG - Intergenic
1093970691 12:25373266-25373288 AAAGTGGACAAGGACTCAGCCGG - Intergenic
1094322334 12:29199301-29199323 CATTTTGAAAAGATCTCAGCCGG + Intronic
1094485877 12:30926062-30926084 CACCTTCACAGGGACTCAGCAGG + Intergenic
1096898412 12:54848415-54848437 CAATTTGAAAAACACACAGCTGG - Intronic
1097646409 12:62239840-62239862 CAATTTGAAAAGGGCTCAGTGGG - Intronic
1098244323 12:68500677-68500699 AAATTTTACAAGGGATCAGCAGG + Intergenic
1101610736 12:106289228-106289250 GAATTTGAACAGGATTCAGCAGG - Intronic
1101743425 12:107519667-107519689 CAATTTTACAAGTACTCTTCAGG + Intronic
1102762440 12:115400004-115400026 GAATTGGAGCAGGACTCAGCTGG + Intergenic
1103152366 12:118651822-118651844 CAATTTGATCAGGACTTGGCAGG - Intergenic
1110531444 13:76603225-76603247 CAATTTGATATGGACTCAATTGG - Intergenic
1111463194 13:88573063-88573085 AACTTTAACAAGGACTAAGCTGG - Intergenic
1114663402 14:24365276-24365298 AAACTTGACAAGGACCCAGGAGG + Intergenic
1116848742 14:49888429-49888451 CAATTTTACAAGGATTAAGCCGG - Intergenic
1118835356 14:69474019-69474041 CAGTTTGTCAAGTACTGAGCAGG - Intergenic
1120022220 14:79543617-79543639 AAATTTTTCAAGGTCTCAGCTGG - Intronic
1121826941 14:97017864-97017886 CAATTTGGGCAGGGCTCAGCTGG - Intergenic
1121971569 14:98361828-98361850 TAATTTGACAAGGAATCTGAGGG + Intergenic
1122114102 14:99519037-99519059 CAGTGTGGCAAGGACTCAGTGGG - Intronic
1122874668 14:104658460-104658482 CAATTTGGGCAGGGCTCAGCAGG - Intergenic
1124794495 15:32763739-32763761 GAATTTGAGAAAGGCTCAGCTGG - Intergenic
1125107783 15:35994091-35994113 CAAGATGACAAGATCTCAGCAGG - Intergenic
1126400226 15:48260979-48261001 CAATCTCACAAGTACTCAGTAGG - Intronic
1126827372 15:52565547-52565569 TTCTTTGACAAAGACTCAGCAGG + Intronic
1128837873 15:70825860-70825882 CAATTTCACAAAGATTCGGCCGG - Intergenic
1130664643 15:85859566-85859588 CCATTTGATAAGGAAACAGCAGG - Intergenic
1132019370 15:98347064-98347086 CAATTTGGGAAGGATTTAGCTGG + Intergenic
1132019442 15:98347599-98347621 CAATTTGGGAAGAATTCAGCTGG - Intergenic
1133728344 16:8557495-8557517 GAATTGCAGAAGGACTCAGCTGG - Intergenic
1135551630 16:23402941-23402963 CAAAATGACAAGAACTCATCTGG - Intronic
1137747642 16:50834860-50834882 CAAGTGGACCAGAACTCAGCGGG + Intergenic
1138347628 16:56329762-56329784 CATTTTCACCAGGTCTCAGCTGG + Intronic
1138621829 16:58217733-58217755 GAATTTGGGAAGGGCTCAGCTGG - Intergenic
1139554346 16:67697125-67697147 CAATTTGACAAGGCCTTGCCTGG + Intronic
1143349326 17:6275922-6275944 CCATTTGCCCAGGACCCAGCAGG + Intergenic
1143822935 17:9579264-9579286 GATTTTGACTAGGAGTCAGCGGG + Intronic
1145742373 17:27286146-27286168 GAATTTGCCCAGGATTCAGCTGG - Intergenic
1147482284 17:40777910-40777932 CTATTTGAGAATGACACAGCTGG + Intronic
1147663586 17:42130637-42130659 TAATTTAAGAAGGACACAGCGGG - Intronic
1147895007 17:43744874-43744896 CTATTAGACAGGGACTGAGCTGG - Intergenic
1151913638 17:77101605-77101627 CAATTTGCAAAGGACTCCCCTGG + Intronic
1156083100 18:33364173-33364195 CAATTTGTTCTGGACTCAGCTGG - Intronic
1162546812 19:11335773-11335795 CCATTTGTCCAGGACACAGCGGG - Exonic
1163170292 19:15526448-15526470 AAAATTAAAAAGGACTCAGCAGG - Intronic
1165555636 19:36629485-36629507 GAATTTGGGAAGGCCTCAGCTGG - Intergenic
1168138265 19:54366348-54366370 CAGGCTGACAAGGTCTCAGCTGG + Intronic
925926401 2:8673931-8673953 TAATCTGACAAGGACTCTGCAGG + Intergenic
926649659 2:15328939-15328961 CCATCTGTCAAGGATTCAGCAGG - Intronic
926907665 2:17821159-17821181 CAATCTGGGAAGGACTCAGTGGG - Intergenic
929114916 2:38435814-38435836 CAAGTGGAGAAGGAGTCAGCAGG - Intergenic
929441686 2:41970239-41970261 CAATTTGAGCAGGGCTCAGTGGG + Intergenic
929636362 2:43525709-43525731 CAATTTGGGCAGGGCTCAGCTGG - Intronic
930260416 2:49140023-49140045 CAATCTGAGAAGCACTAAGCTGG - Intronic
932011868 2:67986565-67986587 CAAGTTGAGAAGGGCTCAGCGGG - Intergenic
932147692 2:69337613-69337635 CATTTTGAAAAGGTCTCTGCTGG - Intronic
932262734 2:70340963-70340985 CAATTTGGGAAGGGCTCAGTAGG + Intergenic
932803925 2:74766984-74767006 GAATTTGGGAAGGGCTCAGCGGG - Intergenic
934036293 2:88091446-88091468 CATTTAGTCAAGGTCTCAGCAGG + Intronic
934063430 2:88318340-88318362 CAATTTGGGCAGGCCTCAGCAGG + Intergenic
936870261 2:117128296-117128318 CAATTTTCAAAGCACTCAGCAGG - Intergenic
938728652 2:134129252-134129274 CAGAGAGACAAGGACTCAGCTGG - Intronic
939173483 2:138722966-138722988 CAAGTAGACAAGGACACAGCAGG - Intronic
941810993 2:169755998-169756020 CATCTTGACAAGGTCTCAGGTGG + Intronic
941905683 2:170715291-170715313 GAATTTGATAAGGACTTTGCTGG - Intergenic
943002959 2:182352275-182352297 CAATGTGACATAGACTCAGGTGG - Intronic
944497973 2:200327952-200327974 CGAAGTGACAAGAACTCAGCTGG - Intronic
946059691 2:216931279-216931301 GAATTTGAGTAGGGCTCAGCTGG + Intergenic
948184997 2:236014053-236014075 CAATTTAACAAGGGCGCAGCAGG - Intronic
948505257 2:238423719-238423741 CGATTTGACAGGGAGGCAGCTGG + Intergenic
1168798139 20:625733-625755 GAATTTAGGAAGGACTCAGCTGG - Intergenic
1169056506 20:2626243-2626265 CAATTTGGGTAGGACTTAGCAGG + Intronic
1170157073 20:13278718-13278740 GAATTTGACTGGGACTCAGCTGG + Intronic
1170480057 20:16756414-16756436 CAAACTGACAAGGTCTCAGATGG - Intronic
1172035676 20:32009319-32009341 TAATTTGACAACCACTAAGCAGG + Intergenic
1172868315 20:38117787-38117809 CAATGTGACCAGCACACAGCTGG - Intronic
1173179046 20:40788111-40788133 CACTTTTACAAGGACCTAGCAGG + Intergenic
1173691349 20:44963556-44963578 CAATTTGAGCATGGCTCAGCAGG - Intergenic
1174476936 20:50802303-50802325 CAGGTGGACAAGGACTGAGCTGG + Intronic
1175671863 20:60910233-60910255 CAATTTTCCAAGGACTCTGTAGG + Intergenic
1177509511 21:22066677-22066699 CAATGTGATTAGGACTCATCTGG + Intergenic
1180202390 21:46232450-46232472 AAATTTGAGGAGGATTCAGCTGG - Intergenic
1182687443 22:32132133-32132155 CAATTTGCAGAGGAGTCAGCAGG + Intergenic
950931277 3:16791322-16791344 AAATTTGACTAAGACTCAGTGGG - Intergenic
951278697 3:20720840-20720862 AAATTTGAGCAGGACTCAGTGGG - Intergenic
952282489 3:31937461-31937483 CAATTTGAGAAGTGCTCTGCTGG - Intronic
952711944 3:36440358-36440380 CAATTTGACAAGGACTCAGCTGG + Intronic
952996270 3:38885550-38885572 CACTTAGAAAAGGACCCAGCAGG - Intronic
956077417 3:65520160-65520182 TAATTTGACTAGGGCTCAGCGGG - Intronic
957365264 3:79214149-79214171 CAATTTGCCATGGTCTCACCTGG - Intronic
959500815 3:107104009-107104031 CAATCTGAGCAGGGCTCAGCTGG - Intergenic
962173756 3:133130322-133130344 CAATCTGGCCAGGGCTCAGCAGG + Intronic
963859786 3:150297321-150297343 GAATTTGGGAAGGACTCAGCTGG + Intergenic
965220374 3:165919801-165919823 GAATTTGGGAAGGACTCAGCTGG + Intergenic
966262723 3:178000014-178000036 CAATTTGACAAGGATTTGGGTGG - Intergenic
967097904 3:186192884-186192906 CTATTTGTCAAGGACTGTGCTGG - Intronic
967482038 3:189983811-189983833 CAATTTGAAAATGAATAAGCTGG + Intronic
967932661 3:194701759-194701781 CAATTAGAAAAGGAAACAGCAGG - Intergenic
969220827 4:5757332-5757354 CAAGTGGACAAGGAGTCAGCGGG + Intronic
972077972 4:35109347-35109369 CAATTTTAAAATAACTCAGCTGG - Intergenic
972434111 4:39015413-39015435 CAATATGAGAAAGACTCAGCAGG + Intronic
973792354 4:54390365-54390387 CAATTAGACAAGGCCACAACTGG - Intergenic
974498270 4:62662032-62662054 CAAGTTGAGAAGAACACAGCAGG - Intergenic
975612500 4:76215863-76215885 CATTTTGAGCAGGGCTCAGCAGG - Intronic
977356476 4:95953125-95953147 CAGTTTGACATGGTCTCAGATGG - Intergenic
977864181 4:102003311-102003333 CAATTTGAGCAGGATTTAGCAGG + Intronic
982911022 4:161143486-161143508 CAGGTTGACAAGGTCTCAGATGG + Intergenic
983554121 4:169044887-169044909 CAATTTGGGCAGGGCTCAGCAGG + Intergenic
983978054 4:173960705-173960727 GAATTTGGGAAGGACTCAGCTGG - Intergenic
989164510 5:38421533-38421555 CACTGTGACAAGCACTAAGCAGG - Intronic
993008053 5:82449405-82449427 AAATGTGCCAAGGACTCTGCAGG + Intergenic
993325951 5:86536728-86536750 CAGTTTGAAAGGGACTAAGCTGG + Intergenic
994820888 5:104649987-104650009 AAATTTGAAAAGGACTCAAAAGG + Intergenic
995572034 5:113490717-113490739 CATTCTGACAAGGTCTCAGATGG + Intergenic
995957113 5:117790554-117790576 CAATTTGACAAGCACCTAACTGG - Intergenic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
998381112 5:141726182-141726204 CAAGCTGACAAGGTCTCAGATGG - Intergenic
999500652 5:152143436-152143458 CAAAGTGACAAAGACCCAGCAGG + Intergenic
1000953754 5:167517646-167517668 CCATTTGTCAATGACCCAGCAGG - Intronic
1003479288 6:6516488-6516510 AAATTTGAGAAGTACTCAGCAGG + Intergenic
1004425628 6:15505168-15505190 GAAGTTCACACGGACTCAGCTGG - Intronic
1004588306 6:17024735-17024757 CAAGTTGACAAGGTCTCAGATGG + Intergenic
1004832918 6:19496568-19496590 CAAGTTGAAAAGCACTCTGCAGG + Intergenic
1005739015 6:28773777-28773799 CAGTTTGACAAGGTTTGAGCAGG + Intergenic
1005887998 6:30111836-30111858 TAATTACACAAGGACTCACCTGG - Intronic
1006843023 6:37042860-37042882 AAATTTGAGAAGGATTCATCTGG - Intergenic
1007366816 6:41399881-41399903 GAATTTGAGAATGACTTAGCTGG - Intergenic
1010924843 6:81732171-81732193 CAATTTGGGCAGGACTCAGAGGG - Intronic
1012358145 6:98341873-98341895 CAATTTAACAAGAAGTGAGCAGG - Intergenic
1015002878 6:128241439-128241461 GAGTTTGACAACCACTCAGCAGG + Intronic
1015602183 6:134921385-134921407 CAAGTAGGGAAGGACTCAGCAGG + Intronic
1015787175 6:136930067-136930089 CAATTTTACTAAGACTCGGCTGG - Intergenic
1017195466 6:151695489-151695511 CATTTTGACAAGGAAACAGTTGG - Intronic
1018845282 6:167551609-167551631 CAAGCTGACAAAGACGCAGCTGG + Intergenic
1019063314 6:169274076-169274098 CAGTCTGACAAGGCCTCAGATGG + Intergenic
1019724751 7:2595375-2595397 CAAGTTGGCAAAGCCTCAGCGGG + Intronic
1023274942 7:38508543-38508565 CATTTTGAAAAGGGCTCAGGTGG + Intronic
1026937079 7:74263745-74263767 CAATTTGACAAGGACAGCCCTGG + Intergenic
1030159160 7:106489813-106489835 CAATTTGGTCAGGGCTCAGCAGG + Intergenic
1030461473 7:109841448-109841470 CCTGTTGACAAGGAATCAGCAGG + Intergenic
1030528947 7:110688187-110688209 GAATTTCAGAAGGGCTCAGCTGG - Intronic
1030867250 7:114714730-114714752 CAATGGGACATGGACACAGCTGG - Intergenic
1032580651 7:133100152-133100174 CAATTTGAGCAGAGCTCAGCAGG - Intergenic
1034627692 7:152506070-152506092 CCATGTGACATGGTCTCAGCTGG - Intergenic
1035320314 7:158024950-158024972 CAAGCAGACAAGGACTCTGCAGG - Intronic
1041447960 8:57974259-57974281 CAAGTTGAGAAGGAATGAGCTGG - Intergenic
1041490046 8:58423383-58423405 CAATTTGAGTTGGGCTCAGCTGG - Intronic
1042206217 8:66332346-66332368 CAATTATACAAGGACCTAGCTGG + Intergenic
1044475602 8:92621668-92621690 CCATTTGAACAGGGCTCAGCAGG - Intergenic
1044557817 8:93583669-93583691 CAATTTATCAAGGTCTCAGATGG + Intergenic
1046760019 8:118011049-118011071 CAATGTGGGAAGGACTCATCTGG + Intronic
1048550005 8:135425348-135425370 GAATTTGAGCAGGACTCAGCTGG - Intergenic
1050123983 9:2337410-2337432 AAATTTGAGAAGCACTGAGCTGG - Intergenic
1050540533 9:6665723-6665745 CTAGTTTACAGGGACTCAGCTGG - Intergenic
1050721113 9:8591062-8591084 CAAAATGAGAAAGACTCAGCTGG - Intronic
1051873760 9:21768940-21768962 CAATGTGAGAAGGACTCGGCTGG + Intergenic
1052001576 9:23288975-23288997 CAAGTTGAAAAGGACCCAGATGG + Intergenic
1055696518 9:78890771-78890793 AAATTTGAACAGGGCTCAGCAGG - Intergenic
1055793854 9:79952844-79952866 CAATTTGCCAAGGACTGTGCAGG - Intergenic
1055910067 9:81339997-81340019 CAACTTGGCAAAGACTCATCCGG + Intergenic
1056949216 9:91028689-91028711 GAATTTGGGAAGGGCTCAGCTGG - Intergenic
1186538182 X:10371539-10371561 CACTTTGAGAAGGGCTCAGCTGG - Intergenic
1187205765 X:17179583-17179605 CAATTCAGGAAGGACTCAGCAGG - Intergenic
1187209643 X:17216757-17216779 CAATTTGAACTGGGCTCAGCTGG + Intergenic
1187228576 X:17398563-17398585 CAATTTGGGCTGGACTCAGCTGG + Intronic
1189077522 X:37932729-37932751 GAATTTGAGAAGGGCTCAGCAGG + Intronic
1189589056 X:42492661-42492683 CAATTTGAGAAGGGCTGGGCAGG - Intergenic
1189602449 X:42641479-42641501 AACTTTGACTAGAACTCAGCAGG + Intergenic
1189914363 X:45842219-45842241 CAATTTGGGCAGGACTCAGCTGG - Intergenic
1190896274 X:54621494-54621516 GAATTTGGGAAGGGCTCAGCTGG - Intergenic
1191638329 X:63402248-63402270 CATTTTGACAAGGACTCAAATGG - Intergenic
1191951439 X:66597917-66597939 CCATTTCACAAGGACTGATCTGG - Exonic
1192656569 X:73000486-73000508 CAAAGTGACAAGGACACAGCAGG - Intergenic
1192665551 X:73082515-73082537 CAAAGTGACAAGGACACAGCAGG + Intergenic
1193411042 X:81163308-81163330 AAATTTGGAAAGGACACAGCAGG - Intronic
1198366917 X:135950247-135950269 GATTTTGACAAGGAATCATCAGG + Intergenic
1198569245 X:137937678-137937700 CAGGCTGACAAGGACTCAGATGG + Intergenic
1199237679 X:145509842-145509864 CAAGTTGACAAGGTCTCAGATGG + Intergenic
1199405235 X:147449855-147449877 GAATGTGAAAAGGACTCAGGTGG + Intergenic