ID: 952713799

View in Genome Browser
Species Human (GRCh38)
Location 3:36457877-36457899
Sequence AATAGCAAATAGAGTTAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 209}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952713799_952713807 6 Left 952713799 3:36457877-36457899 CCAACCTAACTCTATTTGCTATT 0: 1
1: 0
2: 0
3: 12
4: 209
Right 952713807 3:36457906-36457928 GCCAAGTGCGGGTGAGGGGCGGG 0: 1
1: 0
2: 7
3: 33
4: 321
952713799_952713803 0 Left 952713799 3:36457877-36457899 CCAACCTAACTCTATTTGCTATT 0: 1
1: 0
2: 0
3: 12
4: 209
Right 952713803 3:36457900-36457922 TTTAAAGCCAAGTGCGGGTGAGG 0: 1
1: 0
2: 0
3: 9
4: 110
952713799_952713809 7 Left 952713799 3:36457877-36457899 CCAACCTAACTCTATTTGCTATT 0: 1
1: 0
2: 0
3: 12
4: 209
Right 952713809 3:36457907-36457929 CCAAGTGCGGGTGAGGGGCGGGG 0: 1
1: 0
2: 3
3: 27
4: 233
952713799_952713804 1 Left 952713799 3:36457877-36457899 CCAACCTAACTCTATTTGCTATT 0: 1
1: 0
2: 0
3: 12
4: 209
Right 952713804 3:36457901-36457923 TTAAAGCCAAGTGCGGGTGAGGG 0: 1
1: 0
2: 0
3: 4
4: 87
952713799_952713810 8 Left 952713799 3:36457877-36457899 CCAACCTAACTCTATTTGCTATT 0: 1
1: 0
2: 0
3: 12
4: 209
Right 952713810 3:36457908-36457930 CAAGTGCGGGTGAGGGGCGGGGG 0: 1
1: 0
2: 3
3: 21
4: 355
952713799_952713806 5 Left 952713799 3:36457877-36457899 CCAACCTAACTCTATTTGCTATT 0: 1
1: 0
2: 0
3: 12
4: 209
Right 952713806 3:36457905-36457927 AGCCAAGTGCGGGTGAGGGGCGG 0: 1
1: 0
2: 0
3: 20
4: 282
952713799_952713801 -6 Left 952713799 3:36457877-36457899 CCAACCTAACTCTATTTGCTATT 0: 1
1: 0
2: 0
3: 12
4: 209
Right 952713801 3:36457894-36457916 GCTATTTTTAAAGCCAAGTGCGG 0: 1
1: 0
2: 1
3: 16
4: 227
952713799_952713802 -5 Left 952713799 3:36457877-36457899 CCAACCTAACTCTATTTGCTATT 0: 1
1: 0
2: 0
3: 12
4: 209
Right 952713802 3:36457895-36457917 CTATTTTTAAAGCCAAGTGCGGG 0: 1
1: 0
2: 1
3: 18
4: 212
952713799_952713805 2 Left 952713799 3:36457877-36457899 CCAACCTAACTCTATTTGCTATT 0: 1
1: 0
2: 0
3: 12
4: 209
Right 952713805 3:36457902-36457924 TAAAGCCAAGTGCGGGTGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952713799 Original CRISPR AATAGCAAATAGAGTTAGGT TGG (reversed) Intronic
901146277 1:7066899-7066921 AATAGCAAATACAGTCACCTGGG - Intronic
901803407 1:11722437-11722459 AATGTCAAATAGAGATAGCTAGG - Exonic
902526115 1:17058636-17058658 AAAATCAAATAGAGTCAAGTGGG - Intergenic
905384005 1:37586700-37586722 ATTAGGAAATATAGTTAAGTTGG - Intronic
906428523 1:45735074-45735096 AAAAGCAAATAAAATTAGGCTGG - Intronic
908037420 1:60071011-60071033 AAAAGTAAATAGAATTAGTTTGG - Intronic
908334740 1:63110335-63110357 AATTGCAAATAGAAATAGGAAGG - Intergenic
911664312 1:100536760-100536782 AATAGAAAAAAATGTTAGGTGGG - Intergenic
912029625 1:105223630-105223652 AATAGCATATAGAGATATATTGG + Intergenic
914457675 1:147851474-147851496 ACTAGCATATAGAGTGAGGAGGG + Intergenic
915704096 1:157826929-157826951 ACTAGCAAATACAATGAGGTTGG - Intergenic
917878649 1:179311203-179311225 AAAAGTAAAAAAAGTTAGGTGGG + Intronic
918655348 1:187019151-187019173 AATAGCAAATATTATTAGGGAGG + Intergenic
919562864 1:199144408-199144430 AATAGCCAGTGGAGTTGGGTAGG - Intergenic
922520544 1:226246987-226247009 AATAGGAAATACAGTGAGGAAGG - Intronic
923142046 1:231168846-231168868 ATGGGCAAAAAGAGTTAGGTAGG + Intronic
924168173 1:241307144-241307166 AATTGCAAATAGAGATTGGGCGG - Intronic
924462857 1:244274691-244274713 AAAAATAAAAAGAGTTAGGTGGG - Intergenic
1063156932 10:3388539-3388561 AATAGCAAATAATGTCTGGTGGG + Intergenic
1066035600 10:31479505-31479527 AATAGCAAATTGAATTCAGTAGG + Intronic
1066596141 10:37052014-37052036 AATAGCATAAAGAGTGTGGTGGG + Intergenic
1069145034 10:64881124-64881146 GCAAGCAAATAGAGTTAAGTTGG - Intergenic
1069322677 10:67192212-67192234 AAAAGCAAAAAGATTTAAGTGGG + Intronic
1069815721 10:71192756-71192778 AAAAGCAAAAAGAGTTAAGGTGG - Intergenic
1071985094 10:91042388-91042410 AATAGCAGGTAGAATTAGTTGGG - Intergenic
1073926677 10:108524550-108524572 AAATGCAAATAGTGATAGGTTGG + Intergenic
1079050621 11:17154823-17154845 AATAGCAGATAGAGGAAGGATGG - Intronic
1079146323 11:17855491-17855513 AATAGCAAATATATATAGTTTGG - Intronic
1079997576 11:27311154-27311176 AATAGCAACTTGAGCCAGGTAGG - Intergenic
1083355269 11:62061556-62061578 AATAGCAAAGAGAGATAGGAAGG - Intergenic
1083946628 11:65927106-65927128 ATTAGAAAATAGAGATAGGCTGG - Intergenic
1085164602 11:74386634-74386656 AAAAGTAAATAAAATTAGGTGGG - Intronic
1085171302 11:74452063-74452085 AATACCAAATAGAACTAAGTAGG - Intergenic
1086165690 11:83775163-83775185 ACAAGGAAATAGAGTTAGGAGGG - Intronic
1087241953 11:95790111-95790133 AATAACAAATAGGATTAGGAGGG - Intronic
1087850080 11:103018050-103018072 AATAAAAAATAAAGTTAGCTGGG - Intergenic
1087897269 11:103600607-103600629 AATACCTAATAAAGTAAGGTAGG - Intergenic
1087991345 11:104747627-104747649 AATAGAAAATTTAATTAGGTAGG - Intergenic
1088022399 11:105135521-105135543 AAGAGGAAATAGAGTGAGATGGG + Intergenic
1088750702 11:112839917-112839939 AATGGCACAGAGAGGTAGGTGGG + Intergenic
1088797521 11:113276191-113276213 AATACCACCTAGAGGTAGGTAGG + Exonic
1089826544 11:121283075-121283097 AAAAGTAAGTAGAGATAGGTAGG + Intergenic
1091162691 11:133439428-133439450 AAAACAAAAAAGAGTTAGGTTGG - Intronic
1093937289 12:25014810-25014832 ATTAGGAAATAGACATAGGTTGG - Intergenic
1094030088 12:26002135-26002157 TATAACAAATAGAGTTGGTTGGG + Intronic
1094648730 12:32353087-32353109 AAAAGCAAAAAGAGGTAAGTTGG + Intronic
1097024345 12:56043334-56043356 AATAGAAAATAGAGTTATACTGG - Intronic
1100522854 12:95392477-95392499 AGAAGCAAATGGAGTTAGTTAGG + Intergenic
1100918175 12:99451900-99451922 AATAGCAAATAAAACTAGATAGG + Intronic
1101236451 12:102794748-102794770 CAGAGCAAACAGAGTTATGTGGG - Intergenic
1103773317 12:123346312-123346334 AATAGCAAATAGTGTTGAGGAGG - Intronic
1104493133 12:129211934-129211956 AGTAGAAAAAAAAGTTAGGTTGG - Intronic
1107012915 13:35685545-35685567 AAAAAAAAAGAGAGTTAGGTGGG - Intergenic
1110090732 13:71444333-71444355 AATTGAAAAGAGAGTTAAGTAGG - Intronic
1111156646 13:84336864-84336886 AATAGAAAATATAGTTAGGCCGG + Intergenic
1112402901 13:99091039-99091061 AATAGTAAAAAAAATTAGGTGGG - Intergenic
1112610281 13:100948636-100948658 AACAGCAAACAGAGGTAGGTGGG - Intergenic
1112675260 13:101694033-101694055 AATGGAAAATAGAGTGAGGTTGG + Intronic
1114815517 14:25953474-25953496 TATACCAAATAGACTTAGGAGGG + Intergenic
1117431015 14:55661438-55661460 AATAGCAAATGTTGATAGGTAGG + Intronic
1118213236 14:63785300-63785322 AATACAAAATGTAGTTAGGTAGG + Intergenic
1119147317 14:72329167-72329189 AATAACAAATAGTGTTGGTTGGG - Intronic
1119655722 14:76415359-76415381 TATATCAAATAGAGATAGGATGG + Intronic
1120491783 14:85187379-85187401 AAATCCAAATGGAGTTAGGTAGG - Intergenic
1120717362 14:87854464-87854486 AATAAAAAAGAGAGTTAGGCTGG + Intronic
1120895971 14:89532941-89532963 AATCACAAATAGAGAAAGGTAGG + Intronic
1121202242 14:92128072-92128094 AAGAGCAAATAGCGTTAGCCAGG + Intronic
1202831018 14_GL000009v2_random:30467-30489 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1124245178 15:28063681-28063703 GAGAGGAAATAGAGTTATGTAGG - Intronic
1125692171 15:41605023-41605045 AATAGTAAAAAGAGTTAAGGAGG - Intergenic
1127113969 15:55705831-55705853 AATAGCAAGTAGATTTATTTGGG - Intronic
1127504606 15:59586066-59586088 AATAGCAAATATAGGAAGCTAGG + Intergenic
1128820861 15:70651929-70651951 AAAAGCAAATAGACTCAGGGAGG - Intergenic
1130195280 15:81773679-81773701 AATACCATATGGAGTTTGGTTGG - Intergenic
1130725895 15:86439010-86439032 AATAGCAGATAGGGCTTGGTAGG - Intronic
1130952266 15:88602085-88602107 AATAGTTAAGAGAGTTAGCTGGG - Intergenic
1133305405 16:4805120-4805142 AAAAGGAAATGGAGATAGGTGGG + Exonic
1133654279 16:7844785-7844807 AGTAGGAAATAGATTTAAGTGGG + Intergenic
1134237780 16:12481120-12481142 ATTTGCAAATAGGGTTATGTTGG - Intronic
1135333001 16:21576576-21576598 AAAAGTAAAAAGACTTAGGTTGG + Intergenic
1136621914 16:31435270-31435292 AATAACAAAAGGATTTAGGTAGG - Intronic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1142767416 17:2072956-2072978 AATAAAAAATAGAGTTAGGAAGG - Intronic
1145237549 17:21219457-21219479 AATACCAAAAAAAGTTAGCTGGG + Intergenic
1147478889 17:40740160-40740182 ATTAGAAAATAGGGTTAGGACGG - Intergenic
1147948424 17:44093304-44093326 AAGAGCAAAGAGAGTAAGGCAGG - Exonic
1151098780 17:71531701-71531723 AATAGCAAATCGATTTAGTCTGG - Intergenic
1153712561 18:7814594-7814616 AATAGCAAATGAAGTCAGTTGGG + Intronic
1153922584 18:9804662-9804684 ATTAGCAAATAGACTTTGTTTGG + Intronic
1154064522 18:11094623-11094645 AAGAGCAGCTGGAGTTAGGTAGG - Intronic
1155521991 18:26677489-26677511 AATAGAAAAAAAAGTTAGCTGGG + Intergenic
1155528452 18:26741673-26741695 AATAGAAAAGAGAGTTTTGTTGG + Intergenic
1160362091 18:78292261-78292283 AATAGCTAATAGAACAAGGTCGG + Intergenic
1161140744 19:2646286-2646308 AAAAACACATAGAGTTAGTTTGG + Intronic
1161668861 19:5593285-5593307 AAAAGCAAAGAGAATTAGATGGG + Intronic
1161742226 19:6028916-6028938 AATACCAAAAAAAATTAGGTGGG + Intronic
1164550401 19:29206376-29206398 AATGGCAAAAATGGTTAGGTTGG - Exonic
1166359274 19:42245947-42245969 GCTAGCTAATAGATTTAGGTGGG + Intronic
1167056411 19:47113647-47113669 AAGAGCCAATAGTTTTAGGTGGG + Intronic
1202641677 1_KI270706v1_random:97306-97328 AATAGTAAAAAGAATGAGGTAGG - Intergenic
925856834 2:8137152-8137174 GATAACAAATAGATTTAGCTTGG - Intergenic
926583216 2:14654978-14655000 AAGAGAAAATAGAGTTGGGAGGG - Intergenic
930169901 2:48240767-48240789 AATTGCAAGTAGAATTAAGTTGG - Intergenic
930410897 2:51026018-51026040 AACAGCAAGGAGAGTTAGTTAGG - Intronic
930416913 2:51100587-51100609 AATAGAAAATAAGGTTATGTAGG - Intergenic
930844699 2:55889667-55889689 AATAGCATATATAGTTTGGCAGG + Intronic
931985541 2:67738334-67738356 GATAGAAAATAGAGTTTGGAGGG - Intergenic
934099161 2:88635612-88635634 TATAGAAAATAAAGTTTGGTTGG - Intergenic
935039651 2:99413992-99414014 AATAGAAAAAAGAATTAGCTGGG + Intronic
935889763 2:107663593-107663615 AATAGAAAATAAAATTAGCTGGG - Intergenic
942025483 2:171906469-171906491 AATAGCAAAAATAATTAGCTGGG + Intronic
945271154 2:207941601-207941623 AAGAGCAAAAATAGATAGGTAGG + Intronic
945793247 2:214331264-214331286 TATAGCAAACATAGGTAGGTAGG + Intronic
945799431 2:214408340-214408362 AATTGCCTATAGAGTGAGGTTGG + Intronic
945851965 2:215019226-215019248 GATAGCAAAGCGAGTTTGGTTGG + Intronic
946800287 2:223407939-223407961 AATCACAAATAAAGTCAGGTAGG + Intergenic
946992997 2:225357100-225357122 AATAGCAAATAGGCTTAGTGTGG - Intergenic
947431395 2:230031609-230031631 AAAAGAAAGTAGAGCTAGGTCGG + Intergenic
948332911 2:237184145-237184167 AAAAGTAAATAGAGTTTTGTAGG + Intergenic
1168883962 20:1231445-1231467 AAAAGAATATAGAGTTAGTTGGG + Intronic
1174719220 20:52793577-52793599 AATAGCAATTAGAGTTGGAACGG + Intergenic
1176610206 21:8875306-8875328 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1178383672 21:32132599-32132621 AGTAGCCAATGGAGTTAGGTTGG + Intergenic
1179086131 21:38219414-38219436 AACAGTAAACAGAGTTGGGTTGG - Intronic
1180360267 22:11884552-11884574 AATAGTAAAAAGAATAAGGTAGG + Intergenic
952554622 3:34518275-34518297 AATATGAAATAATGTTAGGTGGG + Intergenic
952713799 3:36457877-36457899 AATAGCAAATAGAGTTAGGTTGG - Intronic
954499502 3:50997722-50997744 AACATCAAAAAGAGTGAGGTGGG - Intronic
954546409 3:51439600-51439622 AATAGCAGACAGAATTAGCTGGG - Intronic
957363229 3:79186178-79186200 AAGAGCAAATAAAGTTAACTTGG - Intronic
957471584 3:80665511-80665533 AATAACAAAAACAGTTACGTAGG - Intergenic
957934775 3:86928114-86928136 AATGAAATATAGAGTTAGGTTGG - Intergenic
959961042 3:112298347-112298369 AAAAGGAAATAGAGTGACGTTGG - Intergenic
961226577 3:125255094-125255116 AATAGCAAAAATAGTGAGGCGGG - Intronic
961258383 3:125578336-125578358 AATAGAAAAGAGAGTTTGCTAGG + Intronic
962030451 3:131594678-131594700 AAAAGCAAAAATAGATAGGTAGG + Intronic
962355575 3:134691455-134691477 AATAGCAAAAAAATTTAGCTGGG + Intronic
962669983 3:137695048-137695070 AATGCCAAAGAGAGTTAGGCAGG - Intergenic
1202736888 3_GL000221v1_random:10092-10114 AATAGTAAAAAGAATGAGGTAGG + Intergenic
969167297 4:5327862-5327884 AATAGCAAATAGCTTTATATTGG - Intronic
971203632 4:24538453-24538475 ACTAGCCACTAGAGTTAAGTGGG + Intronic
971360745 4:25936345-25936367 AATACCAAAAAAAGTTAGCTGGG + Intergenic
971744036 4:30556158-30556180 AATATCAAATTGAATTATGTAGG + Intergenic
973084505 4:46039327-46039349 AAAAAAAAATAGAGTTAGCTGGG + Exonic
973312419 4:48723965-48723987 AATAACAAAAAAAATTAGGTGGG + Intronic
973385188 4:49507822-49507844 AATAGTAAAAAGAATGAGGTAGG - Intergenic
974297129 4:60015071-60015093 AATATCAAAAATAGTTTGGTAGG + Intergenic
974420657 4:61668856-61668878 AAAAGTAAATACAATTAGGTGGG + Intronic
975201907 4:71600876-71600898 AAAAACAAATAGTGTTAGATGGG - Intergenic
979790402 4:124773265-124773287 AAAAGCAAATATAAATAGGTGGG + Intergenic
980812632 4:137902573-137902595 AATGGCAAGTAGAGCTACGTTGG - Intergenic
981059258 4:140403936-140403958 AATAGCAATTACTGTTAGGTGGG + Intronic
981689959 4:147497518-147497540 AATAGCCAATAAAGTTAGCCTGG + Intronic
981779862 4:148416313-148416335 TATAGCAAATACATTTATGTAGG + Intronic
982900697 4:160998704-160998726 AAAAGCAAATAGATTCATGTGGG + Intergenic
983040583 4:162920885-162920907 AATAACAAATAGATTTATTTAGG + Intergenic
983741457 4:171139546-171139568 AGTAGAAAAGAGAGTTAGGCTGG + Intergenic
984090885 4:175374203-175374225 AATAGCAAAGTAATTTAGGTTGG + Intergenic
984284845 4:177716288-177716310 AAAAAAAAATAGAGTTGGGTGGG - Intergenic
1202769050 4_GL000008v2_random:183180-183202 AATAGTAAAAAGAATGAGGTAGG - Intergenic
988291214 5:29289504-29289526 AGTAGCAAATATAATTAGCTAGG + Intergenic
991637966 5:68725097-68725119 AATAGAAAATAGAGGAAGGAAGG + Intergenic
992596533 5:78353077-78353099 AATAGGAAATAAAGTTAGAGTGG + Intergenic
992771118 5:80049406-80049428 AATAACAAAAAAAATTAGGTGGG - Intronic
993258773 5:85629637-85629659 AATAAAAAATAAAGTGAGGTTGG + Intergenic
993282624 5:85946075-85946097 AATAAAAAATAAAGTTAGGTGGG + Intergenic
993637704 5:90365418-90365440 ATTAGAAAAAAGAGTCAGGTAGG + Intergenic
993979271 5:94524706-94524728 AATAGCAATTATATTTGGGTGGG + Intronic
994218141 5:97162000-97162022 AATAGCTAGTAGAGTTAATTTGG + Exonic
994880901 5:105494166-105494188 AATATCAAATAGAGTTAAGAAGG - Intergenic
997334509 5:133096976-133096998 AATATCAAAAAGAGTTTTGTAGG - Intronic
998358038 5:141557940-141557962 AATACAAAATGGAGTTAGCTGGG + Intronic
998967283 5:147554234-147554256 AAAAGCACATAGATTTAGGAAGG + Intergenic
999426996 5:151496796-151496818 AATAACAAATAGTGTCAGGAAGG - Intergenic
1001114233 5:168925473-168925495 AATAGAGAAATGAGTTAGGTGGG - Intronic
1004090051 6:12491910-12491932 AATAGCAAACATAATTAGGGAGG + Intergenic
1006917962 6:37608046-37608068 AGTAGCAAATAGAGGCAGCTGGG - Intergenic
1007096661 6:39217518-39217540 AAGAGCAATTAGAGCTAAGTGGG - Intronic
1007873704 6:45070370-45070392 AATACCAAATAAGATTAGGTTGG - Intronic
1009333705 6:62458507-62458529 AAAATCTAATAGAGTTATGTTGG + Intergenic
1009832027 6:68950212-68950234 AATAAAAAATAAAGTTAGTTGGG - Intronic
1012102331 6:95105433-95105455 AATATCAAATAGGGTGATGTTGG - Intergenic
1018647293 6:165960487-165960509 AATTCCAAATACAGTAAGGTTGG + Intronic
1019199521 6:170302841-170302863 AAGAGCAAGAAGAGTTACGTAGG - Intronic
1019757703 7:2785367-2785389 AATATCAAATAGGATTTGGTAGG + Intronic
1020484452 7:8704297-8704319 AAGAGCATATGGAGGTAGGTAGG + Intronic
1022591095 7:31663714-31663736 AATATTAAATACAATTAGGTTGG - Intergenic
1023484941 7:40676239-40676261 AATAGCATATAGAGTATGCTTGG + Intronic
1024141051 7:46463829-46463851 AATAGATGATAGAGTTTGGTTGG + Intergenic
1027689727 7:81328955-81328977 AATAACAAATAGATTTACTTTGG - Intergenic
1027706509 7:81540669-81540691 AAAAGGAAATAGAAATAGGTTGG - Intergenic
1030825993 7:114158904-114158926 AATAACAAAAAGACTTGGGTTGG + Intronic
1031817594 7:126457517-126457539 ATTAGAAAATAGAACTAGGTTGG + Intronic
1033069405 7:138188489-138188511 AATAGCACACAGAGTGGGGTAGG + Intergenic
1033556053 7:142489293-142489315 AATACCAAAAAGAATTAGCTGGG - Intergenic
1037104711 8:15092865-15092887 ATTAGCAAATAGTTTTAAGTGGG - Intronic
1038930935 8:32192898-32192920 AAAAAAAAATAGAGTAAGGTAGG - Intronic
1042138792 8:65658494-65658516 AATAGCAAATTAATTTTGGTTGG - Intronic
1042619524 8:70690017-70690039 AAAAGAAAATTGAATTAGGTTGG + Intronic
1047296931 8:123578840-123578862 AATAGTAAATAAAATTAGCTGGG + Intergenic
1050667529 9:7957910-7957932 AAGAGAAAAAAGAGTTAGATTGG - Intergenic
1051706009 9:19880635-19880657 ATTAGCAAATAATGTTAGCTTGG - Intergenic
1054360655 9:64112465-64112487 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1057373440 9:94495753-94495775 AATAGCAAACAGAGATAAGAAGG + Intergenic
1059053085 9:110949581-110949603 AATAGCAAGTAATTTTAGGTAGG - Intronic
1203693930 Un_GL000214v1:76895-76917 AATAGTAAAAAGAATGAGGTAGG - Intergenic
1203705613 Un_KI270742v1:40536-40558 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1203558382 Un_KI270744v1:25275-25297 AATAGTAAAAAGAATGAGGTAGG - Intergenic
1203642343 Un_KI270751v1:27168-27190 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1186653237 X:11584701-11584723 AATAGATAAGAGACTTAGGTGGG - Intronic
1189831868 X:44982480-44982502 AATATCACATAGTATTAGGTTGG + Intronic
1190829567 X:54047857-54047879 AATAACAAAAAGAGCTAGCTAGG + Intronic
1191067133 X:56360811-56360833 AATAGCAAATATAGTCAAGTGGG + Intergenic
1194419658 X:93657888-93657910 AATAGGAAATAAAACTAGGTGGG - Intergenic
1195198804 X:102526095-102526117 AATATTAAATAGATTCAGGTAGG - Intergenic
1197606011 X:128586356-128586378 GATAAGAAGTAGAGTTAGGTAGG - Intergenic
1197652321 X:129078862-129078884 AAAAGCAAATAGAATTAGAAAGG + Intergenic
1197931655 X:131702822-131702844 CATAGCCAATAGAGGTAGTTAGG - Intergenic
1198086885 X:133290419-133290441 AATAAAAAAGAGAGTTAGGTGGG - Intergenic
1200647699 Y:5807043-5807065 AATAGACAAAAGAGTTAGGCTGG + Intergenic
1201184356 Y:11384696-11384718 AAAAGATAATATAGTTAGGTGGG + Intergenic
1202049975 Y:20770410-20770432 TATTTCAAATAGAGTTAGGTGGG - Intronic