ID: 952717231

View in Genome Browser
Species Human (GRCh38)
Location 3:36492304-36492326
Sequence GGTGTGCTAAAGCATCTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952717231_952717233 15 Left 952717231 3:36492304-36492326 CCACAAAGATGCTTTAGCACACC 0: 1
1: 0
2: 1
3: 9
4: 108
Right 952717233 3:36492342-36492364 ATGCTTAAGAGCACGAGCTCTGG 0: 1
1: 0
2: 6
3: 52
4: 384
952717231_952717234 18 Left 952717231 3:36492304-36492326 CCACAAAGATGCTTTAGCACACC 0: 1
1: 0
2: 1
3: 9
4: 108
Right 952717234 3:36492345-36492367 CTTAAGAGCACGAGCTCTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952717231 Original CRISPR GGTGTGCTAAAGCATCTTTG TGG (reversed) Intronic
905048412 1:35027598-35027620 GGTGTGGTGGAGCATGTTTGTGG + Intronic
906986463 1:50688369-50688391 GGTGTACAAATACATCTTTGAGG - Intronic
907609259 1:55851347-55851369 GTTGGGTTAAAGCATCTTTCGGG - Intergenic
918670626 1:187211015-187211037 TGTCTCTTAAAGCATCTTTGTGG + Intergenic
919190684 1:194214343-194214365 GGATTGCTCAAGCTTCTTTGTGG + Intergenic
924762625 1:247002909-247002931 GGTGTAATAGAGCATCATTGTGG - Intronic
924850456 1:247824009-247824031 CGTGTCCTAAATCTTCTTTGTGG - Intergenic
1075735044 10:124659471-124659493 CGTGGGCTGGAGCATCTTTGGGG - Intronic
1076030556 10:127154224-127154246 GGTGTTTTAAAGAAACTTTGAGG + Intronic
1076269488 10:129139006-129139028 GGTCTTCTAAACCATCTTTGAGG - Intergenic
1077003531 11:337966-337988 GGTGTGGTGATGCATGTTTGTGG - Intergenic
1078532266 11:12145837-12145859 GGTGTGCACAAGCATCTCAGAGG + Intronic
1079624799 11:22603998-22604020 AGTGTTCTAAAGCACCATTGTGG - Intergenic
1085146266 11:74200712-74200734 GGTGTGCTAGAAAATCTCTGTGG + Intronic
1088933411 11:114375309-114375331 GGTAAGCTAATGCATATTTGCGG + Intergenic
1091992356 12:4965770-4965792 TGTGTGATAAAGCATCTATTGGG + Intergenic
1092848004 12:12601943-12601965 GGTGTGAGGAAGCATCTTTTCGG + Intergenic
1094100102 12:26752862-26752884 GGTGTCCTATAACATCTTTCTGG + Intronic
1096114704 12:49049053-49049075 AGGGTGCTAAAGCATGGTTGGGG + Intronic
1098798147 12:74919879-74919901 GTTGTGCTAAAACATGGTTGAGG + Intergenic
1098914474 12:76243063-76243085 GATCTGCCAAAGAATCTTTGAGG + Intergenic
1099293674 12:80803777-80803799 GGAAAGCTAATGCATCTTTGAGG + Intronic
1100392644 12:94157357-94157379 TGTGTGCCAATGCATGTTTGGGG - Intronic
1106120942 13:26859753-26859775 GGTGAGCAAGAGCATCTTTAGGG - Intergenic
1112131380 13:96527595-96527617 GGTCAGATAAAGCATCTTGGAGG + Intronic
1114010382 14:18359872-18359894 GGAGTGCTAACTCTTCTTTGTGG + Intergenic
1118934333 14:70272661-70272683 ATTGTGATAATGCATCTTTGTGG - Intergenic
1202902576 14_GL000194v1_random:51975-51997 GGTGTCCTGGAGCAGCTTTGAGG + Intergenic
1124435792 15:29648165-29648187 GTTGAGCTAAAGCCTCTTTTTGG - Intergenic
1128815422 15:70604736-70604758 GGTGTGCTAAAGTCTCCTGGGGG - Intergenic
1134188323 16:12101268-12101290 GGTGTCCTAATGTACCTTTGTGG + Intronic
1134363803 16:13557656-13557678 GGTGCGCTAATGGAACTTTGAGG + Intergenic
1142116527 16:88359070-88359092 GCTGTGTGACAGCATCTTTGGGG - Intergenic
1144264741 17:13557029-13557051 GGTGAGCTAAGCCATCTCTGTGG - Intronic
1150136753 17:62700073-62700095 GGTGTTATAAAGCTGCTTTGTGG - Intergenic
1153587463 18:6637789-6637811 GGTGTGCTAATGCATGCCTGTGG - Intergenic
1155537861 18:26835859-26835881 GCTGTGATAATGCATCTTTGTGG - Intergenic
1156694649 18:39752616-39752638 GGTGTACAAAAGCATCTTTGGGG - Intergenic
1157655353 18:49381937-49381959 GGTTTGCAAACGCATCTCTGTGG + Intronic
1165809585 19:38604204-38604226 GTTGTGATAATGCACCTTTGTGG - Intronic
1165990185 19:39806570-39806592 GATGTGATAAAAAATCTTTGAGG - Intergenic
1168710523 19:58497544-58497566 GGTGTGCTTAAGCATTGCTGTGG + Intronic
925454129 2:3999758-3999780 GGTGTGCAAAAGAATCATTGTGG - Intergenic
927226339 2:20768701-20768723 GGAGTGTTACAGGATCTTTGGGG - Intronic
928618915 2:33069497-33069519 TGTTTGCTAAGGCATCTCTGGGG + Intronic
933972487 2:87481426-87481448 GGTTTTCTAAAGCATGTTTGTGG + Intergenic
934504090 2:94878420-94878442 GGTGTCCTGGAGCAGCTTTGAGG - Intergenic
936321244 2:111468748-111468770 GGTTTTCTAAAGCATGTTTGTGG - Intergenic
936416348 2:112317370-112317392 GGGGTTTTAAAGCATCATTGAGG + Intronic
936484189 2:112912728-112912750 GGGGTGCAATAGCATTTTTGTGG - Intergenic
940805208 2:158179622-158179644 GGTGTGCTAAAGCTTCTCATTGG - Intronic
942806322 2:179935377-179935399 AATGTGCTCAAGTATCTTTGTGG + Intergenic
944759652 2:202801192-202801214 GATGTGTTAAAGGATCTTTAAGG + Intronic
946030417 2:216699328-216699350 GGTGTCCTAAACCTTCTCTGAGG + Intergenic
946049937 2:216854188-216854210 TTTGTTCTAAAGCATTTTTGAGG + Intergenic
946963117 2:225005971-225005993 GGTGTACAAAAACATCTTGGAGG + Intronic
947088025 2:226477538-226477560 GGTGTCCCAAAGGGTCTTTGCGG + Intergenic
947464695 2:230332177-230332199 TGTTTGCTAAAGAATCTTTGAGG + Intronic
948522383 2:238548236-238548258 GGTGTGTTAAATAATCTCTGAGG - Intergenic
1170632173 20:18075012-18075034 GGTGAGCTAAAACATTATTGTGG - Intergenic
1173055522 20:39608555-39608577 GATGTGCTAGAGCATCTCTAAGG + Intergenic
1176621942 21:9066742-9066764 GGTGTCCTGGAGCAGCTTTGAGG + Intergenic
1180434875 22:15290672-15290694 GGAGTGCTAACTCTTCTTTGTGG + Intergenic
1184315562 22:43685472-43685494 GTTGTGATAATGCATTTTTGTGG - Intronic
949218386 3:1600122-1600144 GGTGTGCTATAGAAACTTGGAGG + Intergenic
950274759 3:11650264-11650286 GTTGTGCCTCAGCATCTTTGTGG + Intronic
952717231 3:36492304-36492326 GGTGTGCTAAAGCATCTTTGTGG - Intronic
954900043 3:54011405-54011427 AGTGAGCTAAAGCATTTTTATGG - Intergenic
955867556 3:63401090-63401112 GGTTTACAAAAACATCTTTGAGG + Intronic
956790299 3:72674932-72674954 GATGTGTAAAAGCATCTTGGAGG - Intergenic
959635613 3:108564494-108564516 GGTCTGCTAAAGCATAGTGGAGG - Intronic
959822676 3:110755257-110755279 GGTGTGCTTAATCATGTTAGTGG - Intergenic
962429603 3:135307058-135307080 GGGGTGCCAGAGCAGCTTTGGGG + Intergenic
964966345 3:162497633-162497655 AGTGTGCTAACTCATCTTTATGG - Intergenic
965632448 3:170747124-170747146 GAGGTGCTAAAGCAGCCTTGAGG - Intronic
968181816 3:196600967-196600989 GGTGTGCAAAGGTCTCTTTGAGG + Intergenic
969304157 4:6316019-6316041 TGTGTGCTGAGGCCTCTTTGAGG + Intergenic
972111348 4:35563241-35563263 TGTGAGCTAAATCATCTTTTTGG + Intergenic
972933164 4:44100364-44100386 GGTGTGCTAATATATTTTTGAGG + Intergenic
976100592 4:81558631-81558653 GGTGTGACAAAGCATCCTTGAGG + Intronic
977427649 4:96889078-96889100 GGTGTGCTTAAGCAATTTTCTGG - Intergenic
978106729 4:104911775-104911797 GTTGTGATAAAGAATGTTTGTGG + Intergenic
981422750 4:144570354-144570376 GGTGTGTTAAGCCAACTTTGGGG - Intergenic
981700735 4:147604448-147604470 AGTGTCATAAACCATCTTTGGGG + Intergenic
984696918 4:182788197-182788219 GGTCTTCTACAGCACCTTTGTGG - Intronic
988702190 5:33686258-33686280 GGTGAGCTGAAGCCTCTGTGAGG - Intronic
989377017 5:40774774-40774796 GGTATGCAAAAGCCCCTTTGTGG - Intronic
990183748 5:53191058-53191080 GTTGGGCTATAGCAGCTTTGTGG + Intergenic
990893877 5:60676285-60676307 GGTGTGCTACAGGATTTTTAAGG - Intronic
996474455 5:123900476-123900498 GGTGTGCAAAAGCAAGTTGGGGG + Intergenic
997405869 5:133646187-133646209 GGTCAGGGAAAGCATCTTTGAGG + Intergenic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1003552882 6:7114518-7114540 GATGTGGAACAGCATCTTTGGGG - Intronic
1006531151 6:34655640-34655662 TGTGTGCTTAAGCTTATTTGTGG - Intronic
1006903041 6:37515265-37515287 TGTGTCCCAAAGCACCTTTGAGG - Intergenic
1023641832 7:42266665-42266687 CGTGTTCTAAAGCAACATTGAGG - Intergenic
1023862102 7:44222876-44222898 GGTGTGCTCATGCATGTGTGTGG + Intronic
1030149382 7:106387431-106387453 GGTCTGCTGAAGTCTCTTTGAGG - Intergenic
1032238040 7:130141376-130141398 GGAGGGCGAAAGCACCTTTGGGG + Intergenic
1035467348 7:159088324-159088346 GGTGTGCTGCAGCATGATTGTGG - Intronic
1035467353 7:159088413-159088435 GGTGTGCTGCAGCATGTGTGCGG - Intronic
1038121228 8:24618222-24618244 GGTGAGCAAAAACATTTTTGTGG - Intergenic
1038892329 8:31739572-31739594 TGTGTGCTAAAACATTGTTGTGG + Intronic
1044044581 8:87415112-87415134 CATGTGGTAAAGCACCTTTGGGG - Intronic
1044507990 8:93042738-93042760 GTTGAGTTAAATCATCTTTGAGG + Intergenic
1046595107 8:116252107-116252129 GGTGTGCTAAAGCAACAGCGAGG + Intergenic
1050230010 9:3513752-3513774 GGTTTGCTTGAGCATTTTTGGGG - Intronic
1053705250 9:40746816-40746838 GGAGTGCTAACTCTTCTTTGTGG - Intergenic
1054415327 9:64870423-64870445 GGAGTGCTAACTCTTCTTTGTGG - Intergenic
1055382762 9:75726753-75726775 GGTGCCCAAGAGCATCTTTGTGG - Intergenic
1058433872 9:104943840-104943862 ACTATGCTAAAGAATCTTTGGGG - Intergenic
1059255398 9:112925908-112925930 GGTGTGCTAGAGGAGCTTTAGGG + Intergenic
1203626053 Un_KI270750v1:24182-24204 GGGGGGCTATAGCATCTTTCTGG + Intergenic
1186715799 X:12250160-12250182 GGTGTGCTGAAGGTTCTTTGTGG + Intronic
1187411860 X:19057991-19058013 ATTGTGCAAAAGCATCTTTTAGG + Intronic
1200085725 X:153603749-153603771 GGAGAGCTAAAGCATCTTAGCGG - Intergenic
1200176147 X:154117594-154117616 GCTGTAGTAAAGCAGCTTTGGGG - Intergenic
1200787126 Y:7270875-7270897 GGTGTGCAACAGCATGATTGTGG + Intergenic
1201158460 Y:11152199-11152221 GGTGTCCTGGAGCAGCTTTGAGG + Intergenic