ID: 952719312

View in Genome Browser
Species Human (GRCh38)
Location 3:36515697-36515719
Sequence ATTTGTCTCAGGTAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 2, 1: 1, 2: 6, 3: 33, 4: 292}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952719312 Original CRISPR ATTTGTCTCAGGTAGGTGGA GGG Intronic
900146390 1:1160697-1160719 CTTGGTCTCAGGTAGGTGCAGGG - Intergenic
903636100 1:24817865-24817887 TTTTGTCTCAGGGAGCAGGAAGG + Intronic
904574940 1:31499347-31499369 ATTTGTCTCAGGTGAGCAGAAGG - Intergenic
905139431 1:35830020-35830042 ATTTGTCCCAGCTAGTTGGGAGG + Intronic
906636014 1:47411227-47411249 ATATGTATCAGATGGGTGGAAGG - Intergenic
907718281 1:56948118-56948140 ATTTGAATCAGGGAGCTGGAAGG + Intronic
907841262 1:58159938-58159960 ATTTGTCTCTAGTAGATAGAAGG - Intronic
908692371 1:66796889-66796911 ATTTGTCTCAGGTGAGCAGAGGG - Intergenic
910198757 1:84675660-84675682 ATTTGTCTCAGGTAAGCAGAGGG - Intronic
912761426 1:112370847-112370869 ATTTGTCTCAGGATGATGGTGGG - Intergenic
913310338 1:117483933-117483955 ATGTGTTTCAGGTATGGGGAGGG + Intronic
915575256 1:156771556-156771578 ATTTGCCTCAGGCAGCTGGGGGG + Intronic
918131167 1:181630990-181631012 ATTGCTCTCAGGCAGCTGGAAGG + Intronic
918298214 1:183177816-183177838 ATTTGTCTCAGGTGAGTAGAGGG + Intergenic
919758128 1:201078687-201078709 ATTGGCTTCAGGTAGGTGGCAGG - Intronic
920010684 1:202865348-202865370 ATTTGTCTCAGGTGAGCAGAGGG + Intergenic
920079820 1:203364723-203364745 AGATGTCTCTGGTAGGAGGAAGG + Intergenic
920113539 1:203603682-203603704 CTTTGTCCCAGGAAGGTGAATGG - Intergenic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
922033697 1:221827992-221828014 ATTTGTCTCAGGTGAGCAGAGGG - Intergenic
922033792 1:221828775-221828797 ATTTGTCTCAGGTGAGCAGAGGG - Intergenic
922327004 1:224537281-224537303 ATTTGTCTCAGGTGAGCAGAGGG - Intronic
922334478 1:224607602-224607624 ATTTGTCTCAGGTGAGTGAAGGG + Intronic
923219908 1:231883580-231883602 ATTGGTCTCAGCAAGGTGGGAGG + Intronic
923876637 1:238056669-238056691 ATTTGTCTCAGGTGAGCAGATGG - Intergenic
924905207 1:248444812-248444834 ATTTGTTTCAGGGGAGTGGAGGG - Intergenic
924922681 1:248647237-248647259 ATTTGTTTCAGGGGAGTGGAGGG + Intergenic
1063164060 10:3443842-3443864 ATTTGTCTCAGGTGAGCAGAGGG + Intergenic
1063376331 10:5556775-5556797 CTTTGTCTCAGGAAGGTGGCAGG - Intergenic
1064302648 10:14136434-14136456 ATTTGTCTCAGGTGAGCAGAGGG - Intronic
1064756925 10:18579877-18579899 ATTTGTCTCAGGTGAGCAGAGGG + Intronic
1065564133 10:26991952-26991974 ATTTGTCTCAGGTCAGCAGAGGG + Intronic
1067824434 10:49559820-49559842 CTTTGTCTCAGGTGGGCAGAGGG + Intergenic
1069640538 10:69952672-69952694 ATTTGGCTAAGGTGGGTGGGAGG - Intronic
1070445471 10:76496517-76496539 AGTTGCTTCAGGTGGGTGGAGGG + Intronic
1072984253 10:100125856-100125878 ATTTGTCTCAGGTGGGCACAGGG + Intergenic
1073529179 10:104215886-104215908 ATTGGCCTTAGGTAGGAGGAAGG - Intronic
1073931258 10:108579353-108579375 ATTTGTCTCAGGTGAGCAGAGGG + Intergenic
1076104353 10:127808803-127808825 ATTTGTCTCAGGTGAGCAGAGGG - Intergenic
1078689279 11:13562683-13562705 GTTTGTCTCATGTTGGAGGAGGG - Intergenic
1078692629 11:13597364-13597386 GTTTGTCTCATGTTGGAGGAGGG + Intergenic
1080582160 11:33652599-33652621 TTTTATCTCAGGTTGTTGGAAGG - Intronic
1081255458 11:40888341-40888363 ATTTGTTTCCAGTAAGTGGAAGG + Intronic
1081323377 11:41717414-41717436 ATCTGTCTCAGGTGGGAAGAGGG - Intergenic
1082200030 11:49355343-49355365 TTTTGTCTCAGGGAAGAGGATGG + Intergenic
1083543575 11:63532184-63532206 ATTTGTCTCAGGTGAATGGAGGG - Intergenic
1083710938 11:64547918-64547940 ATGTGTATCTGTTAGGTGGAAGG + Intergenic
1084394375 11:68899124-68899146 CTCAGCCTCAGGTAGGTGGAGGG + Intronic
1086655645 11:89350855-89350877 TTTTGTCTCAGGGAAGAGGATGG - Intronic
1086912489 11:92488996-92489018 ATTTGACTCTCCTAGGTGGATGG - Intronic
1087146582 11:94819394-94819416 ATTTGTCTCAGGTAAGCAGAGGG - Intronic
1087399947 11:97652241-97652263 CTCTGTCTCAGGGAGGTGTAAGG + Intergenic
1087476032 11:98636380-98636402 ATTCATCTCAGGTAATTGGAAGG - Intergenic
1088447974 11:109952523-109952545 ATTTGTTTCAGGTGAGTAGAGGG - Intergenic
1089836424 11:121374448-121374470 CTTTGTGTCAGGTAGGCAGAGGG + Intergenic
1090264828 11:125347233-125347255 ATTTGTCTCAGCTAGGGTCAGGG + Intronic
1090453221 11:126824786-126824808 ATTTGTCTCAGGTGAGCAGAAGG + Intronic
1091745952 12:2992916-2992938 ATTTGTCTCATGTTAGGGGAAGG + Intronic
1092039390 12:5370674-5370696 ATGTGTCTGAGCTTGGTGGAGGG - Intergenic
1092142951 12:6196510-6196532 ATTTGTCTCAGGTGAGCAGAGGG + Intergenic
1092546695 12:9458261-9458283 ATTTGTCTCAGGTGAGAAGAGGG + Intergenic
1092554272 12:9539761-9539783 ATTTGTCTCAGGTAAGCAGAGGG + Intergenic
1094506240 12:31063812-31063834 ATTTGTCTCAGGTGAGAAGAGGG - Intergenic
1094517828 12:31150869-31150891 ATTTGTCTCAGGTAAGCAGAGGG - Intergenic
1096663272 12:53143479-53143501 ATTTGTCTCAGATGAGCGGAGGG - Intergenic
1097494664 12:60315654-60315676 ATTTGTCTCAGGTGAGCAGAGGG + Intergenic
1099040688 12:77650393-77650415 ATTTTTCTCAGGTTGGTTGTTGG - Intergenic
1099711721 12:86234901-86234923 ATTTATTTCAGGAAGATGGAAGG - Intronic
1101901607 12:108794905-108794927 ATTTGTGTCAGATGGGTAGAGGG - Intronic
1101989331 12:109471616-109471638 ATTTTTCTGAGGGAGGTGGCTGG - Intronic
1103489020 12:121302525-121302547 ATTTGTCTCAGGTGAGTAGAGGG - Intergenic
1104753637 12:131255491-131255513 ACCTGGGTCAGGTAGGTGGAAGG - Intergenic
1106375614 13:29184201-29184223 ATTTGTCAAAGGTAGCTGAACGG - Intronic
1107229965 13:38097060-38097082 ATTTGTGTCAGGTGGGCAGAGGG - Intergenic
1108972435 13:56393743-56393765 ATTTGTCTCAGGTGAGCAGAAGG - Intergenic
1109820558 13:67647040-67647062 ATTTGTCTCAGGTGGGTAGAGGG + Intergenic
1110605438 13:77426783-77426805 ATTTGTTTCAGGTAAGCAGAGGG - Intergenic
1110965163 13:81685586-81685608 ATTTGTCTCAGGTGAGCAGAGGG + Intergenic
1111492531 13:89000592-89000614 TTTTGTGTCAGGGAGGTGTATGG + Intergenic
1113155291 13:107313612-107313634 ATTTGTCTCAGGTGAGCGGAGGG - Intronic
1114382995 14:22228196-22228218 ATTTGTCTGGGGTAGGAGGTGGG - Intergenic
1114814530 14:25941851-25941873 TTTTGTCTTAAGTGGGTGGAGGG - Intergenic
1116309914 14:43311833-43311855 ATTTGTCTCAGGTGAGCAGAGGG - Intergenic
1117094136 14:52280639-52280661 ATTTGTCTCAGGTGGACAGAGGG - Intergenic
1118903024 14:70002364-70002386 GTTTGTATCAGGTAGAGGGAGGG - Intronic
1119836735 14:77756794-77756816 ACTTGAATCCGGTAGGTGGAGGG + Intronic
1202889612 14_KI270722v1_random:143671-143693 ATTTGTGTCAGGTGGGCAGAGGG - Intergenic
1125043766 15:35222725-35222747 ATTTGTCTCAGGTGAGCAGAGGG + Intronic
1125430835 15:39591613-39591635 ATCCGGATCAGGTAGGTGGATGG + Exonic
1126429603 15:48567406-48567428 ACTGGTCTCAGTTAGGGGGAAGG - Intronic
1127379152 15:58414564-58414586 ATTTCTCACAGGTTTGTGGATGG - Intronic
1127897598 15:63316110-63316132 ATTTGTCTCAGGTGAGTGAAGGG + Intergenic
1127901438 15:63344069-63344091 ATTTGTCTCAGGTGAGCAGAGGG - Intronic
1129869353 15:78930798-78930820 ATGTGCCCCAGGGAGGTGGAGGG + Intronic
1129950287 15:79581286-79581308 AATTGGCTGAGGTGGGTGGATGG + Intergenic
1130131505 15:81147040-81147062 CTTTGTCTCAGGTGAGAGGAAGG - Intronic
1130732753 15:86516180-86516202 ATTTGTCTCAGGTGAACGGAGGG + Intronic
1131176134 15:90210900-90210922 GCTTGTCTAAGGCAGGTGGAGGG + Intronic
1132334067 15:101032427-101032449 ACTTGTATCGGGTAGGGGGAGGG - Intronic
1133652259 16:7823360-7823382 ATTTGTCTCAGGTGAGCAGAGGG + Intergenic
1135807368 16:25555129-25555151 ATTTGTCTCAGGTGAGTGGAGGG - Intergenic
1136475487 16:30510583-30510605 ATTTCTCTTAGGTAGGGGCAAGG - Intronic
1137417016 16:48292191-48292213 ATTTGTCTCAGGTGAGCAGAGGG + Intronic
1138859039 16:60732790-60732812 AATTGTCTCATGTAGTTGGAAGG - Intergenic
1139314172 16:66054180-66054202 ATTTGTCTCAGGTGAGCGGCAGG - Intergenic
1139425621 16:66878227-66878249 ATTTTTCTCAGGAAAGTGGCGGG + Intergenic
1141035439 16:80621825-80621847 CCTTGTCTTAGGCAGGTGGAGGG + Intronic
1141249019 16:82338104-82338126 ATTTGTCTCATGTGAGTAGAGGG + Intergenic
1141386969 16:83630649-83630671 ATTTGTCTCAGGTGAGCAGAGGG + Intronic
1142038159 16:87875324-87875346 ATTTGCTTCAGGTGGGCGGAGGG + Intergenic
1142414914 16:89936131-89936153 AGTTGTGTCCAGTAGGTGGAGGG + Intergenic
1143269120 17:5662690-5662712 ATCTCTCTCAGTTAGGTGGCGGG - Intergenic
1144706622 17:17372681-17372703 ATTTGTCTCCGGTGGGCAGAAGG - Intergenic
1145941708 17:28746197-28746219 GTCTGAGTCAGGTAGGTGGAAGG - Intronic
1146698037 17:34926500-34926522 ATTTGTTAAAGCTAGGTGGAGGG + Intergenic
1147197027 17:38773848-38773870 AATGTTCTCAGGTGGGTGGAGGG - Intronic
1147237672 17:39069740-39069762 AGTTTTCTCAGGTATGTGGCAGG + Intronic
1147522835 17:41190655-41190677 ATATGTCTCTGGTGGGTGGTGGG - Intronic
1151176218 17:72290428-72290450 ATTTGATGCAGGGAGGTGGAGGG - Intergenic
1153149812 18:2079029-2079051 ATTTGTCTCAGGTGAGCAGAGGG - Intergenic
1153158957 18:2181016-2181038 TTCTGTCTTAGGTAGGAGGAAGG + Intergenic
1154205734 18:12335235-12335257 ATTTGTCTCAGGTTGGCAGAGGG - Intronic
1154318439 18:13325031-13325053 ATTTGTCTCAGGGCGGCAGAGGG + Intronic
1155786825 18:29912933-29912955 AGTTGTCTCAGGGGGGTGCATGG - Intergenic
1156644183 18:39140168-39140190 ATTTGTCTCAGGTGAGCCGAGGG + Intergenic
1157212893 18:45759170-45759192 ATTTGTATCAGGTGGGAAGAGGG - Intergenic
1158617911 18:59004921-59004943 CTGTGTCTCAGGTAGGTCCAGGG + Intergenic
1159708578 18:71724587-71724609 ATTTGTCTCAGGTGAGCAGAGGG + Intergenic
1159828187 18:73241132-73241154 ATTTGTCTCAGGTGAGCAGAGGG + Intronic
1164137838 19:22429435-22429457 ATTTGTCTCAGGTGAGCAGAGGG + Intronic
1165609467 19:37138052-37138074 ATTTGTCTCAGGTGAGCAGAGGG - Intronic
1166512737 19:43420688-43420710 ATTTGTCTCAGGTGAGCAGAGGG - Intergenic
1166973460 19:46587958-46587980 ATTTGTCTCAGGTGAGAAGAGGG - Intronic
1167117502 19:47496769-47496791 CTTTGTCTCAGGTCTGTGGCTGG + Intronic
1168002599 19:53461191-53461213 ATTTGTCTCAGGTGTGCAGAGGG - Intergenic
1202665014 1_KI270708v1_random:110438-110460 ATTTGTGTCAGGTGGGCAGAGGG - Intergenic
924973131 2:149423-149445 ATTTGTCTCAGGTGAGCAGAAGG - Intergenic
925644483 2:6021902-6021924 ATTTGTCTCAGGTTAGCAGAAGG + Intergenic
926208416 2:10850381-10850403 ATTTGTCTCAGGTAAGCAGAGGG - Intronic
926265924 2:11320639-11320661 AGTTGTTTCAGGTGGCTGGAAGG - Intronic
926283601 2:11469898-11469920 ATTTGTCTCAGGTGAGCAGAGGG - Intergenic
926594036 2:14770642-14770664 ACTAGTCTCAGTGAGGTGGAAGG - Intergenic
927657314 2:24960363-24960385 TTTTGTCTCAGGGAAGAGGAAGG - Intronic
928780899 2:34819299-34819321 ATTTGATTCAGGTAGGGGAAAGG + Intergenic
930596650 2:53397796-53397818 ATTTATTTTAGGTGGGTGGAGGG - Intergenic
932727610 2:74193012-74193034 ATTTGTCTCAGGTAAGCAGAGGG + Intergenic
932882614 2:75518044-75518066 CTTTGTCTCAGGTAGGTGCCTGG - Exonic
933640833 2:84757819-84757841 TTGTCTCTCAGGAAGGTGGAAGG - Intronic
934887049 2:98034041-98034063 GTTTGTCTCAGGTGAGCGGAGGG - Intergenic
934955193 2:98611523-98611545 ACTTGTCTCAGGTGAGTAGAAGG + Intronic
936668497 2:114627604-114627626 ATTTTTTTTAGGTAGGGGGAGGG + Intronic
937087557 2:119181465-119181487 GCCTCTCTCAGGTAGGTGGAAGG - Intergenic
939069955 2:137526997-137527019 ATTTCTCTAAGGAAGGTAGAAGG - Intronic
939997550 2:148933989-148934011 ATGTGTCTGATGTATGTGGAAGG - Intronic
941962120 2:171263721-171263743 ATTGGTCTCAGTCAGCTGGATGG + Intergenic
942276341 2:174326586-174326608 ATTTGCCTCAGGAAGGAGGGTGG - Intergenic
942339303 2:174926574-174926596 ATTTGTCTCAGGTTGGCACAGGG - Intronic
942839257 2:180340020-180340042 ATGTGTCTCAGGGAGTTGTATGG - Intergenic
943179881 2:184528541-184528563 CATTGTCTCAGGAATGTGGATGG + Intergenic
943256379 2:185598761-185598783 ATTTGTCTCAGGTGAGCAGAGGG + Intergenic
943384581 2:187185465-187185487 ATTAGCCTAAGGTAAGTGGAAGG - Intergenic
943598208 2:189882645-189882667 ATTTGTCTCAGGTGAGCAGAAGG + Intronic
944927534 2:204480228-204480250 ATTTGTCTCAGGTGAGCAGAGGG - Intergenic
945319898 2:208409009-208409031 GGTTGTCTCAGTTAGGGGGAGGG - Intronic
945708152 2:213261575-213261597 ATATCTCTCAGGCTGGTGGAAGG + Intergenic
946315858 2:218911596-218911618 CCTTGTGTCAGGGAGGTGGATGG - Intergenic
947232446 2:227902009-227902031 AGTTTTCTCAGGGAAGTGGAAGG + Intronic
947368361 2:229419682-229419704 ATTTGTCTTAGGTAGGTCAAGGG - Intronic
947964944 2:234272216-234272238 ATTTGTCTCAGCTGGGCAGAGGG + Intergenic
948322203 2:237079554-237079576 ATTTGTTTCAGGTGGGCAGAGGG + Intergenic
1169010195 20:2244070-2244092 TTTTGTATATGGTAGGTGGAGGG - Intergenic
1169117399 20:3074564-3074586 ATTTGTCTCAGGTGAGCAGAGGG + Intergenic
1169443417 20:5651923-5651945 ATTTGTCTCAGGTGAGCAGAGGG - Intergenic
1169695231 20:8380135-8380157 TTTTGTATAAGGTAGGAGGAAGG + Intronic
1172213768 20:33219459-33219481 ATATGTCTGAGGTAGGAGCAAGG - Intronic
1173951862 20:46999711-46999733 ATTTGGCTCAGCCAGGGGGAGGG + Intronic
1175757343 20:61538167-61538189 ATTTGTCTGAGATATGTGGTGGG + Intronic
1176255218 20:64148348-64148370 ATTTGTCTCAGGTGGGCAGTGGG + Intergenic
1177675295 21:24290169-24290191 ATATTTCTGAGGAAGGTGGAGGG - Intergenic
1178165450 21:29969951-29969973 ATTTGTCTCAGGTGAGCAGAGGG - Intergenic
1178835885 21:36097127-36097149 ATTTGTCTCAGGTAGGTGGAGGG - Intergenic
1178926542 21:36780094-36780116 AATTGTGTGGGGTAGGTGGATGG - Intronic
1180331739 22:11487358-11487380 ATTTGTGTCAGGTGGGCAGAGGG - Intergenic
1181336350 22:22133443-22133465 ATTTGTCTCAGGTGAGGAGAGGG + Intergenic
1182013586 22:27020826-27020848 ATTTGGGGCAGGTGGGTGGAAGG - Intergenic
1182453932 22:30437797-30437819 ATTTGTCTCAGGTGAGCAGAGGG + Intergenic
1183607786 22:38876479-38876501 ATTTGTCTCGGGTGGGAAGAGGG + Intergenic
949587218 3:5453673-5453695 ATTTGTGTCAGGTGGGCAGAGGG + Intergenic
950499502 3:13354734-13354756 AAATGTCCCAGGAAGGTGGAAGG + Intronic
950653672 3:14423436-14423458 CCTTGTCTCAGGTGGGTAGAAGG + Intronic
951765615 3:26195122-26195144 ACTTGTTTCTGGTTGGTGGAAGG + Intergenic
952193255 3:31046321-31046343 ATGTGTCTCAGGGAGTTGCATGG - Intergenic
952455218 3:33466233-33466255 ATTTGTCTCAGCAGGGTGCACGG + Intergenic
952719312 3:36515697-36515719 ATTTGTCTCAGGTAGGTGGAGGG + Intronic
953777249 3:45830795-45830817 ATTTGTCTCAGGGAGTAGCAGGG + Intronic
955436725 3:58907960-58907982 ATTTCTTTCAGGTATTTGGAAGG - Intronic
955841914 3:63121645-63121667 ATTTGTATCATATAAGTGGAAGG - Intergenic
957090880 3:75728906-75728928 ATTTGTGTCAGGTGGGCAGAGGG + Intronic
957090892 3:75729027-75729049 ATTTGTGTCAGGTGGGCAGAGGG + Intronic
957090904 3:75729147-75729169 ATTTGTGTCAGGTAGGCAGAGGG + Intronic
957090917 3:75729267-75729289 ATTTGTGTCAGGTGGGCAGAAGG + Intronic
957440624 3:80242179-80242201 ATTTGTCTCAGGTGAGCAGAGGG - Intergenic
958567700 3:95835912-95835934 ATTTGTCTCAGGTGAGCAGACGG + Intergenic
958744208 3:98113471-98113493 ATGTGTCTTGGGAAGGTGGAGGG - Intergenic
960246237 3:115403433-115403455 ATTTGTCCTGGGTGGGTGGAAGG + Intergenic
960509402 3:118530556-118530578 ATTTGGCACAGGTAGGCAGAGGG + Intergenic
960660479 3:120052595-120052617 ATTTTTCTGAGGTAGGTCCATGG - Intronic
961029341 3:123588256-123588278 ATTTGTCTCAGGTGAGGAGAGGG - Intergenic
961253934 3:125530569-125530591 ATTTGTTTCAGGGAGATGGCTGG - Exonic
962089275 3:132226221-132226243 ATTTGTCTCAGGTGAGCAGAGGG - Intronic
962710486 3:138081733-138081755 TTGTCTCTCAGGAAGGTGGAAGG - Exonic
963892991 3:150656743-150656765 ATTTGTCTCAGGTGAGCAGAGGG + Intergenic
963967861 3:151393452-151393474 ATTTGTCTCTGATAAGTGGAGGG + Intronic
966359202 3:179116034-179116056 ATTTGTCTCAGGTGAACGGAGGG - Intergenic
966389769 3:179439623-179439645 ATTTGTCTCAGGTGAGTGGAGGG - Intronic
966648740 3:182275045-182275067 ATTTGTCTGTGGTAGGTCGCTGG - Intergenic
967317025 3:188159296-188159318 ATCTGACTCAGGTAGGTGATAGG - Intronic
968036025 3:195548684-195548706 CTTTGTCTCAGGTAAGCAGAGGG + Intergenic
968598763 4:1499354-1499376 ATTGGTGGCAGGTAGGTGGAAGG + Intergenic
969030399 4:4208094-4208116 ATTTGTCTCAGGTGCGCAGAGGG + Intronic
969054162 4:4391132-4391154 CTTTGGCTCTGGTGGGTGGAAGG + Intronic
969655356 4:8494374-8494396 ATTTGTCTCAGGTGAGCAGAGGG - Intergenic
970409748 4:15792768-15792790 AGTTGTGTCAGGTAGGATGATGG - Intronic
972222217 4:36968744-36968766 ATTTGTCTCAGATGGGCAGACGG + Intergenic
973152563 4:46906746-46906768 ATTTGTCTCAGGGAGGAAGAGGG - Intronic
975310669 4:72899828-72899850 ATTTGTCTCAGGTGAGCAGAAGG + Intergenic
975376233 4:73649677-73649699 ATTTGTGTCAGGAAGGAGCAAGG + Intergenic
975885341 4:78958416-78958438 ATTTGTCAGGGGTAGGGGGATGG - Intergenic
976213053 4:82691399-82691421 AATTGTCTCAGGTAGAGGGAAGG + Intronic
976690916 4:87866255-87866277 ATTTGTCTCAGGCAAGGGGAGGG - Intergenic
977151752 4:93521128-93521150 CTTTGGCTTACGTAGGTGGAGGG + Intronic
978705960 4:111711655-111711677 ATCTGTCTCAGATATGTTGATGG - Intergenic
979232680 4:118363936-118363958 ATTTTTCTCAAGTGGTTGGATGG + Intergenic
979858407 4:125663494-125663516 ATTTTTCTCAGGTGAGGGGAGGG + Intergenic
981281979 4:142969043-142969065 ATTTGTCTCAGGTGAGCAGAAGG + Intergenic
982447173 4:155506121-155506143 ATTTGTCTCAGGTGAGCGGAGGG + Intergenic
982476546 4:155858888-155858910 ATTTGCCTCAGGTGAGTAGAGGG + Intronic
982490169 4:156020255-156020277 ATTTGTCTCAGGTGAGTACAGGG + Intergenic
983658752 4:170110550-170110572 ATTTGTCTCAGGTTCGGTGAGGG - Intergenic
983804797 4:171981357-171981379 ATTTGTCTCAGGTGAGCAGAGGG + Intronic
984501958 4:180567889-180567911 ATCTGTGTCAGGTATGTGGCAGG + Intergenic
984718293 4:182946130-182946152 ATTTGTCTCAGGTGAGCGGAGGG + Intergenic
985421395 4:189788494-189788516 ATTCATCTCAGGTGGGCGGAGGG + Intergenic
987276369 5:16367266-16367288 ATTTAACTCAGGTAGCTGGTTGG - Intergenic
988388179 5:30593606-30593628 ATTTGTCTCAGGTGAGCAGAGGG + Intergenic
992114969 5:73531198-73531220 ATTTGTCTCATGTGAGCGGAGGG - Intergenic
992453310 5:76892861-76892883 ATTTGTCTCAGGTGAGTGGAGGG + Intronic
992541987 5:77775152-77775174 ATTTGTCTCAGGTGGGTAGAGGG - Intronic
993977845 5:94504243-94504265 AATTATCTCAAGTAGGTAGAGGG + Intronic
994010303 5:94894614-94894636 ATGTGTCTCTGGAAGGAGGAGGG + Intronic
994612056 5:102055632-102055654 AGTTGTCTGAGGTCGGGGGAAGG + Intergenic
995885149 5:116886154-116886176 TGTGGTCTCAGCTAGGTGGAAGG - Intergenic
997358093 5:133277344-133277366 AATTGTGTCAGGTAGGAGGACGG + Intronic
999726383 5:154441759-154441781 ATTTGTCTCAGGTGAGCAGAGGG - Intergenic
1002426214 5:179177732-179177754 AACTGCCTCAGGTAGGTAGAAGG - Intronic
1003099521 6:3166400-3166422 ATTTGTCTCTAGTGAGTGGAGGG - Intergenic
1003235578 6:4292701-4292723 ATGTTTCTCAGGTATGTTGAGGG - Intergenic
1004653104 6:17631188-17631210 ACTTGCCTCTGGTAGGTGTAAGG - Intronic
1005300793 6:24468322-24468344 ATTTGTCTCAGGTGAGCAGAGGG - Intronic
1005313832 6:24585502-24585524 ATTTGTCTCAGGTGAGCAGAGGG - Intronic
1005624336 6:27649168-27649190 ATTTGTCTCAGGTGAGCAGAGGG - Intergenic
1008132536 6:47735153-47735175 ATTTGTCTCAGGCAAGCAGAAGG - Intergenic
1008142328 6:47846248-47846270 AACTGTCTTAGGTAGATGGAAGG - Intergenic
1008447008 6:51604043-51604065 ATTTGCCTACAGTAGGTGGAGGG + Intergenic
1013467729 6:110431939-110431961 ATTTGTTTCAGGTAGGGAGTGGG + Intronic
1013871434 6:114766529-114766551 ATTTGTCTCAGGTGAGCAGAGGG + Intergenic
1014035139 6:116758243-116758265 AATTCTCTCAGTGAGGTGGAAGG + Intronic
1014434459 6:121405886-121405908 ATTTGTCTCAGGTGAGCAGAGGG - Intergenic
1015029925 6:128582655-128582677 GTCTGTCTCAGGTAGATAGAAGG - Intergenic
1016211456 6:141539737-141539759 ATTTGTCTCAGGTGAGCAGAGGG - Intergenic
1017042605 6:150319585-150319607 ATTTGTCTCAGGTGAGCAGAGGG + Intergenic
1018815472 6:167327236-167327258 ATTTGCCTCAGGTAAATGGAGGG + Intronic
1018925221 6:168201226-168201248 ATTTGTCTCAGGTGGGCGGAGGG + Intergenic
1019001332 6:168755475-168755497 ATTTGTGTCTGCTGGGTGGAGGG - Intergenic
1021049973 7:15971109-15971131 AATTGTCTTATGTAGATGGAAGG + Intergenic
1022908801 7:34880564-34880586 ATTTGTCTCAGGTGGGCAGAGGG - Intergenic
1024409145 7:49019101-49019123 ATTTGTCTCAGGTGAGCAGAGGG + Intergenic
1024582888 7:50814445-50814467 ATTTGTCTCAGGTGGGCAGAGGG - Intergenic
1024589847 7:50871868-50871890 ATTTGTCTCAGGTGAGCAGAGGG + Intergenic
1025733245 7:64124921-64124943 ATTTGTCTCAGGTGAGCAGAGGG + Intronic
1025930657 7:65991042-65991064 ATTTGTCTCAGGTGGGTGGAAGG - Intergenic
1026561870 7:71457098-71457120 ATTTGTCTCAGGTGAGCAGAGGG + Intronic
1031247897 7:119340494-119340516 AATTGTATAAGGAAGGTGGAAGG - Intergenic
1034591092 7:152139663-152139685 ATGAGTCTCAGGTAGGTGTCTGG - Exonic
1036146160 8:6256821-6256843 ATTTGTCTCAGGTGAGCGAAGGG + Intergenic
1037403481 8:18517344-18517366 ATTTGTCTTAGGTGAGTAGAGGG - Intergenic
1037701167 8:21274950-21274972 TTTTGTGGCAGGGAGGTGGATGG - Intergenic
1037707805 8:21330402-21330424 ATTTGTCTCAGGTGAGCAGAGGG + Intergenic
1037964943 8:23126986-23127008 ATTTGTCTCAGGTGGACAGAGGG - Intergenic
1038029252 8:23622793-23622815 CCTTTTTTCAGGTAGGTGGAAGG - Intergenic
1039290760 8:36092085-36092107 ATTTGTCTCAGGTGAGCAGAGGG + Intergenic
1039608950 8:38903937-38903959 ATCTGTCTCAGTGAGCTGGATGG + Intronic
1040395639 8:46997573-46997595 CTTTGTCACAGGTAGGAGAATGG + Intergenic
1041350194 8:56940630-56940652 ATTTGTCTCAGGTGAGCAGAGGG - Intergenic
1042008832 8:64215577-64215599 GTTTGTCTCATGGAGGTAGAAGG + Intergenic
1042143262 8:65700932-65700954 ATTTGTCTCAGGTGAGCAGAGGG - Intronic
1042446137 8:68887274-68887296 ATTTGTTTAAAGTATGTGGAAGG + Intergenic
1044118495 8:88364819-88364841 ATTTGATTTAGGTAGGTAGAAGG - Intergenic
1046647224 8:116799366-116799388 CTTTGTCTCAGGAAGTTTGATGG + Intronic
1048306597 8:133288928-133288950 ATTCCTCCCAGGCAGGTGGATGG - Intronic
1049250259 8:141584550-141584572 ATTTGTCTCAGGTGAGCGGAGGG - Intergenic
1051629960 9:19131837-19131859 ATTTGTCTCAGGTGAGCAGAGGG - Intronic
1051819036 9:21143099-21143121 TTTTGTCTAAGGAAGGTGGAAGG + Intergenic
1052190383 9:25654646-25654668 ATTTGTCTCAGGTGAGCAGAAGG + Intergenic
1052380628 9:27767160-27767182 ATTTGTCCCAGGTGGGTGAAGGG - Intergenic
1053017196 9:34668843-34668865 ATTTGTCTCAGGTGAGCAGAGGG - Intergenic
1053346512 9:37382487-37382509 GTTTGGCTCAGGTACCTGGATGG + Intergenic
1053514572 9:38719684-38719706 ATATGTCTCATGTTGGTTGATGG - Intergenic
1056058191 9:82851647-82851669 ATTTGTCTCAGGTGAGCAGAAGG - Intergenic
1061829257 9:133280307-133280329 ATTTGTCTGAAGCGGGTGGAGGG + Intergenic
1203486735 Un_GL000224v1:63092-63114 ATTTGTGTCAGGTGGGCAGAGGG - Intergenic
1203499357 Un_KI270741v1:4992-5014 ATTTGTGTCAGGTGGGCAGAGGG - Intergenic
1186050789 X:5592739-5592761 ATTTGTCTCAGGTGAGCAGAGGG - Intergenic
1187652868 X:21429536-21429558 ATTTCTTTCATGTAAGTGGATGG - Intronic
1187880568 X:23843343-23843365 ATTTGTGACAGGGTGGTGGATGG - Intronic
1188311613 X:28624204-28624226 ATTTGTCTCAGGTGTGACGATGG - Intronic
1188440432 X:30210504-30210526 ATTTGTTTCAGGTGAGTAGAGGG - Intergenic
1188520728 X:31034677-31034699 ATTACTCTCAGATAGGAGGAGGG - Intergenic
1188645760 X:32565014-32565036 TTTTGTCTTATGTAGTTGGATGG - Intronic
1190084310 X:47382171-47382193 ATTTGTCTCAGGTGAGCAGAGGG + Intronic
1190951795 X:55152880-55152902 ATTTGTCTCAGGTGAGCAGAGGG - Intronic
1190975333 X:55394603-55394625 ATTTTTCTCAGGTAAGCAGAGGG + Intergenic
1191191837 X:57676115-57676137 GTTTGTCTTAGGTGGGTAGAGGG + Intergenic
1192330757 X:70173448-70173470 AGGAGTCTCAGGTTGGTGGAGGG - Intergenic
1193266116 X:79471839-79471861 CTTTGTCTCAGGTAAGCAGAGGG - Intergenic
1193273112 X:79551968-79551990 ATTCATCCCAGGTAGTTGGAAGG + Intergenic
1193681522 X:84525336-84525358 ATTTGTCTCAGGTAATCAGAGGG - Intergenic
1196749555 X:119102865-119102887 ATTTGTCTCAGGTGAGCAGACGG - Intronic
1197945319 X:131832202-131832224 ATTTGTCTCAAGTGAGCGGAGGG + Intergenic
1199108380 X:143899977-143899999 ATTTGTGTCAGGTAGGCAGGGGG + Intergenic
1199398419 X:147367698-147367720 ATTTGTCTCAGGTGAGCAGAGGG + Intergenic
1199629369 X:149766875-149766897 ATTTTTCTCAGGTATGAGCATGG - Intergenic
1201343252 Y:12956238-12956260 CTTAGTCTGAGGTAGTTGGACGG - Intergenic
1201908226 Y:19106545-19106567 ATTTGCTTGAGGAAGGTGGAAGG + Intergenic