ID: 952719639

View in Genome Browser
Species Human (GRCh38)
Location 3:36519025-36519047
Sequence CTGGGATTCCAGAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 463}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952719630_952719639 18 Left 952719630 3:36518984-36519006 CCCAGGTAACTTACAGCAGCCTC 0: 1
1: 0
2: 2
3: 9
4: 140
Right 952719639 3:36519025-36519047 CTGGGATTCCAGAAGGAAGAGGG 0: 1
1: 0
2: 3
3: 54
4: 463
952719631_952719639 17 Left 952719631 3:36518985-36519007 CCAGGTAACTTACAGCAGCCTCA 0: 1
1: 0
2: 0
3: 10
4: 134
Right 952719639 3:36519025-36519047 CTGGGATTCCAGAAGGAAGAGGG 0: 1
1: 0
2: 3
3: 54
4: 463
952719634_952719639 -1 Left 952719634 3:36519003-36519025 CCTCAAAGGGACGTGAAAGAAGC 0: 1
1: 0
2: 1
3: 6
4: 115
Right 952719639 3:36519025-36519047 CTGGGATTCCAGAAGGAAGAGGG 0: 1
1: 0
2: 3
3: 54
4: 463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952719639 Original CRISPR CTGGGATTCCAGAAGGAAGA GGG Intronic
900908968 1:5580601-5580623 CTGGGGTCCTGGAAGGAAGAGGG - Intergenic
901412959 1:9097804-9097826 CTTGGAGGTCAGAAGGAAGATGG - Intergenic
902672312 1:17983319-17983341 CTGCGGTGGCAGAAGGAAGAGGG + Intergenic
903467244 1:23560093-23560115 CTGAGATTGCAGAAGGAGGAGGG + Intergenic
903780895 1:25819646-25819668 CTGGGCTTCCAGAAGTCGGATGG + Intronic
904555018 1:31355858-31355880 CTTGGATTCCAGCAGGAGGTTGG + Intronic
904868964 1:33604639-33604661 ATGGGATGCCAGAATGAAGAGGG + Intronic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
905208062 1:36354230-36354252 CTGGGATTCCTGGAGGAAGTGGG + Intronic
905506023 1:38480385-38480407 CTGGGCCTCCAGAAGGAACTGGG + Intergenic
905516936 1:38568943-38568965 GAGGGCTTCCAGAAGTAAGAGGG + Intergenic
905898566 1:41565639-41565661 CTGGGCTCCCAGGAGGAAGCTGG - Intronic
906870365 1:49472822-49472844 TGGGGATTCCAGAAGGAGGGAGG - Intronic
908671238 1:66549946-66549968 CTGTTGTTCCAGAAGGAAGCAGG + Intronic
910290584 1:85596660-85596682 CTGGAATTGTAGAAGGAAGCGGG - Intergenic
911803378 1:102174155-102174177 CTGGGATTCCTGGAGAAATATGG - Intergenic
912980825 1:114370000-114370022 TTGGGGTTCCACAAGGAAAAAGG - Intergenic
913072135 1:115309101-115309123 CTGGGATACCTGAAGCAATAAGG + Intronic
913088514 1:115460204-115460226 CAGAGATGCCAGAAGGAAGTGGG - Intergenic
913280564 1:117181436-117181458 CAGGGATTCCTAAAGGGAGAAGG - Intronic
915057894 1:153152656-153152678 CAGGGATGCCAGAAGGAACAGGG + Intergenic
915080139 1:153346289-153346311 CTGGGATTTGAGGAGGCAGAGGG - Intronic
915225457 1:154407882-154407904 CTTGCATTGCAGTAGGAAGAGGG - Intronic
915340952 1:155176303-155176325 GTGGGTTTCCAAAAGGAAGTGGG + Intronic
915564811 1:156707388-156707410 CTGGGCTTCTGCAAGGAAGAGGG + Intergenic
916167689 1:161978368-161978390 CTGGGGATACAGAAGGCAGAGGG - Intergenic
916484400 1:165245251-165245273 CTAGGATTCTAGAGGGAGGAAGG - Intronic
916755956 1:167770561-167770583 ATAGGAAACCAGAAGGAAGAGGG + Intronic
916895892 1:169161625-169161647 CTGTGAGGCCAGAAGCAAGATGG - Intronic
917115990 1:171604029-171604051 CTCTGATTCCAGGAGTAAGATGG - Intergenic
918248609 1:182682251-182682273 CTGGGATTGAGAAAGGAAGATGG + Intronic
918535870 1:185573784-185573806 ATGGGCTTCCAGACGGAAGGAGG + Intergenic
918625437 1:186651714-186651736 CTGAGAGTTCAGAAAGAAGATGG - Intergenic
918809284 1:189094445-189094467 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
918922947 1:190738551-190738573 AAGAGATTCAAGAAGGAAGAGGG - Intergenic
919848331 1:201655565-201655587 CTGGGCCTCCTGAAGGAAGCAGG + Intronic
920604406 1:207366491-207366513 CTGGGATTCCAGCTTGAAGATGG - Intergenic
920954626 1:210607029-210607051 CTGGGGGTGAAGAAGGAAGAGGG + Intronic
921595335 1:217048301-217048323 GTTGGATTCCAGATGGAACACGG + Intronic
922973839 1:229766984-229767006 TTGGGACTCCAGTAGGAGGATGG + Intergenic
923640791 1:235758294-235758316 CTGGGGTAGCAGAAGGAAAATGG + Intronic
1063131001 10:3176592-3176614 CTGGGTTTCCAGAAAGTAGGAGG - Intergenic
1064372416 10:14764054-14764076 CTGGTATACCAGAAAGCAGATGG + Intronic
1065035838 10:21637997-21638019 ATAGGATTCCAGAAGGACAAAGG - Intronic
1065208003 10:23375306-23375328 CTGGGAAGCCAGAAGCAAGATGG + Intergenic
1065545234 10:26812746-26812768 CTGGTATTCTTGAAAGAAGAGGG - Intronic
1066175406 10:32898575-32898597 CCGGGACTCCAAAAGGGAGAGGG + Intergenic
1066337050 10:34488654-34488676 CTGGGCTTCCAGGCGGACGACGG - Intronic
1068643514 10:59438381-59438403 CTGGGACTCAAGCAGGAGGAAGG + Intergenic
1069200465 10:65608718-65608740 TAGGGATTCCAAAAGGAGGAAGG + Intergenic
1069647164 10:70009082-70009104 TTGGGCTTCCAGCAGGAAGAGGG + Intergenic
1070340840 10:75496944-75496966 CTAGGATTCCTGAGGGGAGAGGG - Intronic
1072583840 10:96764158-96764180 CTGGGATTACAGGAGGCAGCTGG + Intergenic
1073223761 10:101898539-101898561 CTGAGATACCTGAAGGAAGCAGG + Intronic
1073327457 10:102650948-102650970 CTGGGAAACTGGAAGGAAGATGG - Intronic
1073331244 10:102671151-102671173 CTGGGAGTCCCGAAGGGAGGGGG + Intergenic
1073608591 10:104920967-104920989 CTGGGCTCCCATAAGGAAGTTGG - Intronic
1073664137 10:105510533-105510555 CTTGGAGTTCAGAAGCAAGATGG + Intergenic
1076668592 10:132106569-132106591 CTCGGATACCAGAAGGCCGATGG + Intronic
1076691411 10:132225493-132225515 CTGGGGTTCCAGATGGGAGCTGG - Intronic
1077235166 11:1478489-1478511 CCAGGAGGCCAGAAGGAAGAAGG - Intronic
1077394206 11:2313176-2313198 CCGGGCTTCCAGAAGGCAGCCGG + Intronic
1078302817 11:10150462-10150484 ATGGGATTACTGATGGAAGAGGG + Intronic
1078449234 11:11428057-11428079 CTGGGCTAACGGAAGGAAGAGGG - Intronic
1078464589 11:11540873-11540895 CTGGGTTGTCAGAAGGAAAATGG + Intronic
1078877170 11:15410411-15410433 CTAGGAGTTCAGAAGGAAGCAGG + Intergenic
1078879459 11:15433770-15433792 ATAGGATTCCAAAAGGCAGAAGG + Intergenic
1078991787 11:16655151-16655173 CTGGGATTCTAGGATGCAGATGG + Intronic
1079762301 11:24344384-24344406 CTGGGATTCAAGCTGCAAGAGGG - Intergenic
1081847965 11:46254127-46254149 CTGGGGATCCAGAAAAAAGAAGG - Intergenic
1081989397 11:47329652-47329674 TTGGGAATGCAGAAGGAAGCAGG - Exonic
1082767337 11:57180215-57180237 CGGGGATTCCAGGAGGAGGGAGG + Intergenic
1082869186 11:57928256-57928278 CTGGGAATAAAGAAGGAATAAGG + Intergenic
1083832743 11:65243330-65243352 CTGGGATTACAGAGAGGAGAAGG + Intergenic
1084032690 11:66490393-66490415 CTGAGACTCCAGAAGGAATGCGG - Intronic
1085405183 11:76257394-76257416 CAGGGATTCCAGGAGGAACTGGG - Intergenic
1085621637 11:78042125-78042147 CTGTGACACCAGAAGCAAGATGG - Intronic
1086033967 11:82394587-82394609 CAGGGTTCCCAGAAGAAAGATGG + Intergenic
1086229200 11:84548190-84548212 CTGGCAGTGGAGAAGGAAGAAGG - Intronic
1086662728 11:89441346-89441368 TTGGTTTTCCAGAAGGTAGAAGG - Intronic
1086901699 11:92374796-92374818 ATGGAATTTCAGAAGGAAGATGG - Intronic
1087374917 11:97327702-97327724 CTGGCTTTCAATAAGGAAGAAGG - Intergenic
1087917050 11:103823171-103823193 CTGGGAGTAGAGAAGGTAGAAGG + Intergenic
1088210725 11:107453455-107453477 CTGGTATTCAAGATGCAAGATGG - Intronic
1089802319 11:121043685-121043707 CTGGGAGTGGAGAAGGAAGATGG - Intronic
1090097545 11:123757747-123757769 CTGGGAGGCAAGAAAGAAGATGG - Intergenic
1091249653 11:134132245-134132267 CTTGGAGGCCAGAAGGAAGTGGG + Intronic
1091993479 12:4974681-4974703 CTGGGAATCCAAAATGAAGGAGG - Intergenic
1092055174 12:5502966-5502988 CAGGGATTACAACAGGAAGAAGG + Intronic
1092529774 12:9334823-9334845 CTGGGACCCCAAAAGGATGAGGG + Intergenic
1092673363 12:10888088-10888110 CTGGCATTGAAGATGGAAGAAGG - Intronic
1092702414 12:11246944-11246966 CTGGCATTGAAGATGGAAGAGGG + Intergenic
1092711993 12:11348699-11348721 CTGGCATTGAAGATGGAAGAGGG + Intergenic
1092981612 12:13800089-13800111 CAGTGATTCCAGGAGGAAAATGG - Intronic
1093017171 12:14166249-14166271 CTGAGATCCCCTAAGGAAGACGG + Intergenic
1093278444 12:17158964-17158986 CTGGCATTCAAAAAGGAAGTTGG + Intergenic
1094359560 12:29615619-29615641 CTGGGAGTCCTGATGGATGAGGG - Intronic
1094361734 12:29638400-29638422 ATGGGGATCCAGAAGGGAGATGG - Intronic
1094714128 12:32994739-32994761 CTAGGATGCCTGAAAGAAGAAGG - Intergenic
1095184613 12:39187047-39187069 CTGGGGACCCAGAAGGGAGATGG - Intergenic
1096803022 12:54123958-54123980 CTGGGAATCCAGGGCGAAGAAGG + Intergenic
1096950907 12:55469983-55470005 CTGGGAATCCAGCAGAATGAGGG + Exonic
1097177393 12:57151376-57151398 AGGGGATTCCAGCATGAAGAGGG - Intronic
1099143370 12:79008202-79008224 CTGGAATATCTGAAGGAAGAGGG + Intronic
1099308069 12:80982993-80983015 CTTGAATTCCAAAAGGAAGAAGG - Intronic
1100761537 12:97812604-97812626 CTGGAATGCTAGAGGGAAGATGG + Intergenic
1102636866 12:114332378-114332400 CCTGGATTCAAGAAGGAAGGGGG - Intergenic
1102694373 12:114786724-114786746 CTGGCATTCCACAGGGAACAAGG + Intergenic
1103359679 12:120346323-120346345 CTGGCAACCCAGAAAGAAGACGG + Intronic
1103680941 12:122693076-122693098 CTTGGAGTTCAGAAGCAAGATGG + Intergenic
1106350586 13:28926067-28926089 TTGGGATTAAATAAGGAAGAGGG - Intronic
1106663520 13:31827147-31827169 CTGGTATTACAGAAAGAAGCTGG + Intergenic
1106907784 13:34426936-34426958 CTGAGATTTCAGAAAGAAGAAGG - Intergenic
1107340222 13:39397581-39397603 CTGAGATGCCAGAGGAAAGAGGG - Intronic
1108240014 13:48454509-48454531 CTGGGAATACAGAAGTAAGATGG + Intronic
1108605989 13:52039080-52039102 ATGGGCTTTCAGCAGGAAGAGGG + Intronic
1108671784 13:52697552-52697574 CAGGGATTCCAGAAAAAAAATGG - Intronic
1109019258 13:57064526-57064548 CTAGGCTTCCAGATGGAGGAGGG - Intergenic
1109305059 13:60629434-60629456 CTAGGGTACTAGAAGGAAGATGG - Intergenic
1110713105 13:78671587-78671609 CTGGGAATCCAGGAGGTAGAAGG + Intergenic
1112191356 13:97181024-97181046 CTGGCTTTCAAGATGGAAGAAGG - Intergenic
1112591814 13:100770351-100770373 CAGGACTCCCAGAAGGAAGAGGG - Intergenic
1112849246 13:103684430-103684452 CGTGGATTCATGAAGGAAGAGGG - Intergenic
1112912657 13:104507514-104507536 CTGGGTCTCCAAAAGGAGGAAGG - Intergenic
1114549244 14:23523750-23523772 CTGGGGTTCCAGATGGAATGGGG - Exonic
1114775148 14:25473352-25473374 CTGGCATGCCAGAGGGGAGAGGG + Intergenic
1116617338 14:47155388-47155410 CTGGGTTTCCCGAAGGACCATGG - Intronic
1116690917 14:48104357-48104379 CTGGGACCCTAGAAGCAAGATGG + Intergenic
1117413034 14:55467991-55468013 CTGGGCTTCTAGAAGGGCGACGG + Intergenic
1119084869 14:71730444-71730466 CTGGGATTACAGGAGAGAGAGGG - Intronic
1119771748 14:77224485-77224507 CTGGGATCCCAGAAGGAAGCAGG + Intronic
1120031567 14:79647100-79647122 CTTGGATTTCACAATGAAGAGGG + Intronic
1120056240 14:79927448-79927470 CTGGGATGCCTTGAGGAAGAAGG - Intergenic
1120120788 14:80678516-80678538 CTTTAATTCCAGAAGGAAAATGG + Intronic
1121317072 14:92968653-92968675 CTGGGATTTCAGAAGGGTGGGGG - Intronic
1125911221 15:43441152-43441174 ATGCGATTGCAGAAGGAACAAGG + Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1129175005 15:73833452-73833474 CTGGGATTCAAGGAGGACCATGG + Intergenic
1129878952 15:78994674-78994696 GTGGCATTCCAGACGGAATAAGG - Intronic
1131414085 15:92236967-92236989 CTTGGAGTTCAGGAGGAAGATGG - Intergenic
1133026527 16:2991129-2991151 CTGGGCTTCCAGGAGGGAGGGGG + Intergenic
1133026816 16:2992192-2992214 CTGGGATTCTAGAAGACACAGGG + Intergenic
1133173607 16:3997556-3997578 CTGCGCTTGCAGAAGGAAGGGGG + Intronic
1133607058 16:7398117-7398139 CTAGGATTCCACATGGAAGAAGG + Intronic
1133929698 16:10222304-10222326 CTAGAATTGCAGATGGAAGAAGG + Intergenic
1133971010 16:10568009-10568031 CTGGGCTTCCTGAGGCAAGACGG - Intronic
1135225428 16:20652522-20652544 ATGGGATTACACAAGAAAGAGGG + Intronic
1135504804 16:23027260-23027282 GTGGGATTGAAGAGGGAAGAAGG + Intergenic
1135533757 16:23276774-23276796 CTGGGATTACAGATGTAAGCTGG + Intergenic
1137882263 16:52062381-52062403 CTGGCAATGCAGATGGAAGAAGG - Intronic
1138029754 16:53550914-53550936 CTGGGATTGGGGAAGGCAGAAGG - Intergenic
1138440026 16:57028635-57028657 CTGGGATTTCAGAAAGAGGGAGG - Intronic
1138527564 16:57617884-57617906 TTGGGGTACCAGAAGGGAGAAGG - Intronic
1141087538 16:81107659-81107681 CTGGGCTGCCTGCAGGAAGAGGG - Intergenic
1141360064 16:83387390-83387412 CTGTGATTCCAGAAGGTATTGGG + Intronic
1141711109 16:85699396-85699418 CTGAGAAGCCAGAAGGAAGGGGG + Intronic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1144400100 17:14887522-14887544 CTTCAATTCCAGAAGGAAAATGG - Intergenic
1144765111 17:17728341-17728363 CTTGGAGACCAGAGGGAAGACGG - Intronic
1144825472 17:18103389-18103411 CAGGGATTTCAGCAAGAAGAGGG - Intronic
1146243567 17:31255830-31255852 CTGGGAGTGGAGAAGGAACAAGG - Intronic
1146380072 17:32321713-32321735 CTGGGGCTCCAGTAAGAAGAGGG + Exonic
1146596416 17:34173000-34173022 CTGTGAGGCTAGAAGGAAGATGG + Intronic
1146906326 17:36620657-36620679 CTATGATTCCATAAGGAAGGAGG + Intergenic
1146919237 17:36698834-36698856 CTGGAATGCCAGGAGTAAGAAGG + Intergenic
1147418633 17:40311085-40311107 CAGGGATGGCAGAAGGAAGGTGG - Intronic
1147450311 17:40500225-40500247 CTGGGATTCTGGAACCAAGAGGG + Intronic
1148985151 17:51614302-51614324 CTAATAATCCAGAAGGAAGAAGG + Intergenic
1149687081 17:58542185-58542207 CTGGGATTCCAGGAGGGGAAAGG - Intronic
1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG + Intronic
1150280581 17:63927785-63927807 CTGGAATTCCAGAGGGAATCTGG + Intergenic
1151315160 17:73317339-73317361 CTGGGGTTGCAAATGGAAGAAGG - Intergenic
1151334977 17:73434416-73434438 CTTGGAAGCCAGAAGCAAGACGG + Intronic
1151678887 17:75613831-75613853 CTGGGCTTGGAGAAGGAGGAGGG - Intergenic
1151711307 17:75808586-75808608 CTGGGATGCAGGAAGGAGGAAGG - Intronic
1151886140 17:76924310-76924332 ATGGGATGCCAGATGGCAGAGGG + Intronic
1152561063 17:81079032-81079054 CTGGGATTCCAGAAAGGAGCTGG + Intronic
1153930368 18:9873411-9873433 GTGGGTTTGCAGAAGGATGAGGG + Intergenic
1154145211 18:11861266-11861288 CAGGGACCCTAGAAGGAAGAAGG - Intronic
1154160215 18:11975745-11975767 TGGGGATTCCAAAAGGAAGGAGG + Intergenic
1155180346 18:23340015-23340037 CTGGGATTTCAGGGGGAAAAAGG - Intronic
1155357208 18:24964750-24964772 CTGGGAGGCTAGAAGCAAGATGG + Intergenic
1156269391 18:35517085-35517107 CTGGAGTTGCAGGAGGAAGATGG - Intergenic
1156494307 18:37515928-37515950 CTGGGATGCTACAATGAAGAAGG - Intronic
1158318415 18:56237379-56237401 CTGGGTTTGAAGAAGGAGGAAGG + Intergenic
1158862587 18:61607058-61607080 CTGGCATTCCCAAAGGAAGTGGG + Intergenic
1159001983 18:62982543-62982565 CTGGATTTCCAGCAGGAAGCAGG - Intergenic
1159657350 18:71048073-71048095 CTGAGATTGAGGAAGGAAGAAGG - Intergenic
1159782123 18:72672354-72672376 CTCTGCTTCCAGAAGCAAGAGGG - Intergenic
1160801916 19:974242-974264 CTGAGATCCGAGAAGGAAGTGGG - Exonic
1161070455 19:2257306-2257328 CTGGGAGTCCTGAGGGAAGAGGG + Intronic
1161670363 19:5604449-5604471 CTGAGACTCCAGCAGGAAGCTGG + Intronic
1162101256 19:8340603-8340625 CAGGGATTCGAGAAGCCAGAAGG - Intronic
1162148845 19:8630900-8630922 ATGAGATCCCAGAAGGGAGATGG - Intergenic
1162791889 19:13067261-13067283 CTGACATTCCAGAAGCAAGTGGG - Intronic
1163189609 19:15666957-15666979 CTGGGCTTCCTGAAGGATAAGGG - Intergenic
1163720831 19:18897419-18897441 CCAGGATACCAGACGGAAGAGGG - Intergenic
1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG + Intronic
1165141747 19:33704000-33704022 CTGGGGTCCCAGAGGGAAGTCGG + Intronic
1165529178 19:36382415-36382437 CTGGAATTCTAGAGGCAAGAGGG + Intergenic
1165593085 19:36987753-36987775 CTGGGATTCAAGAAAGACAAAGG + Intronic
1166210290 19:41302561-41302583 GTGGCCTTCCAGAAGGGAGAAGG - Intronic
1167771548 19:51523370-51523392 CTGGGATCCCAGAAAGGGGAAGG + Intronic
1168158773 19:54493949-54493971 CATGGGTTCCAGAAGGAACATGG + Intergenic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925851774 2:8088708-8088730 CTAGCATTCCAGAGGGAAGGAGG + Intergenic
926007532 2:9384308-9384330 CTGTGAGGCCAGAAGCAAGATGG + Intronic
926414853 2:12639564-12639586 CTTGGATTGCAGAATAAAGATGG - Intergenic
927288042 2:21377446-21377468 CTGGCTTCCCAGAAGGAAGGAGG + Intergenic
927508546 2:23630009-23630031 GGGAGTTTCCAGAAGGAAGAAGG + Intronic
927558314 2:24050822-24050844 CTGGGATTGGACAAGGAAGATGG - Intronic
928100851 2:28436732-28436754 CTGTGATTCCAGGAGGGCGAGGG - Intergenic
928469773 2:31562661-31562683 CAGGGATTCCAAAAGGGAAAAGG + Intronic
929554371 2:42916161-42916183 ATGGGATTGTTGAAGGAAGAAGG + Intergenic
929923167 2:46188184-46188206 CTGGGCTGTCAGAAGGAATAAGG + Intergenic
930602412 2:53457503-53457525 TTGGGATTTTTGAAGGAAGAAGG - Intergenic
931441111 2:62291259-62291281 CTGTGAGGCCAGAAGCAAGATGG - Intergenic
932030909 2:68183541-68183563 CCAGGATTCCAGAAGGAAAATGG - Intronic
932442924 2:71749247-71749269 CTGGGGTTCTAGAAGGAGGCAGG + Intergenic
932978352 2:76631754-76631776 CTCCCATTCCAGAAGTAAGAAGG + Intergenic
933315222 2:80706815-80706837 CGGGGGAGCCAGAAGGAAGATGG - Intergenic
933318532 2:80743778-80743800 CTAGAATTCAGGAAGGAAGAGGG - Intergenic
933774115 2:85761562-85761584 CTGGGCTTCCAGGAGGGAGCAGG - Intronic
933895783 2:86808648-86808670 CTGGGCCCCCAGATGGAAGACGG - Intergenic
934495328 2:94791396-94791418 CTGGAATTCCAAGATGAAGATGG + Intergenic
934534096 2:95118605-95118627 CAGGGATTCCAGAGGGAAGGGGG - Intronic
934608290 2:95714408-95714430 GTGGGATTCCAGAAGGAGTTGGG + Intergenic
935061805 2:99615214-99615236 CTGGGAGTCCAGATGGTAGAGGG + Intronic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
936225314 2:110644153-110644175 TGGGAATACCAGAAGGAAGAAGG + Intronic
936460720 2:112712245-112712267 CAGGGATGCCAGAAGGAAGGGGG - Intergenic
937955096 2:127417670-127417692 CCGGGGTGCCAGAAGGGAGAAGG - Intergenic
940613710 2:156024118-156024140 AAGGGCTTCCAGAAGGAAGCTGG + Intergenic
941704559 2:168644186-168644208 CTAGGATTACAGAAGGGGGAGGG + Intronic
941770529 2:169340563-169340585 GTGGGATTGCAGAAGGAGAAAGG - Intronic
942249388 2:174034517-174034539 CTGGGATGCCGGAAGGAGGGTGG + Intergenic
942417974 2:175778568-175778590 CTGGTATAACAGAAGGAAGCTGG - Intergenic
942856042 2:180549837-180549859 CTGGCTTTGAAGAAGGAAGATGG - Intergenic
943420150 2:187659316-187659338 CTGGGATTCAAGCTGCAAGATGG + Intergenic
944083065 2:195811855-195811877 CTGTGAGGCCAGAAGCAAGATGG - Intronic
944289689 2:197991320-197991342 CTGGGATTCCAGCTTGCAGATGG + Intronic
944981413 2:205124947-205124969 TTGGGATACCAAAAGCAAGAGGG + Intronic
945212100 2:207394437-207394459 CTGAGGTTACAGAAGGAAGGAGG + Intergenic
945247562 2:207733106-207733128 AAGGGATCCCAGAAGGCAGATGG + Intronic
945400973 2:209382437-209382459 CAGGGATTGCAGAAGGTAGAGGG + Intergenic
947404858 2:229764593-229764615 CTGCTAAGCCAGAAGGAAGACGG + Intronic
947538069 2:230953421-230953443 CTGGGTTTGAAGACGGAAGAAGG + Intronic
947992938 2:234501075-234501097 CTGGGAGTCGAGAATGAAGGAGG + Intergenic
948286525 2:236790178-236790200 CTGGAAATCCAAAATGAAGATGG - Intergenic
1169133421 20:3180425-3180447 CTGGCTTTGCAGATGGAAGAAGG + Intergenic
1169373018 20:5043179-5043201 CTGGGGAGCCAGAAGGAAGCTGG - Intergenic
1169801866 20:9518795-9518817 CTGTGCATCCAGAAGGCAGAGGG + Intronic
1169927637 20:10799500-10799522 CTGGGATTAGGGAAGGGAGAGGG - Intergenic
1170562161 20:17567898-17567920 CTGGGATTATAGAAGGAACTAGG + Intronic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1170912251 20:20584465-20584487 CTAGGATTCCAGGAATAAGAAGG + Intronic
1171025640 20:21628265-21628287 CTGGCAAGCCAGAAGTAAGAGGG - Intergenic
1171161866 20:22933346-22933368 CTTGGAATTCAGAAGAAAGATGG + Intergenic
1171793738 20:29550630-29550652 CTGGGAATCCAGGGTGAAGAAGG - Intergenic
1171854732 20:30333760-30333782 CTGGGAATCCAGGGCGAAGAAGG + Intergenic
1172226629 20:33309726-33309748 CTGGGTTTCCACAAGGAGGCTGG - Exonic
1172910341 20:38404321-38404343 CCTGGATCCCAGAATGAAGAGGG - Intergenic
1172979187 20:38928040-38928062 CTGGGGATCAAGGAGGAAGAAGG + Intronic
1172993832 20:39055387-39055409 CTGATATTCCTTAAGGAAGAAGG - Intergenic
1173416144 20:42857879-42857901 CTGGGATTGTAGAGGGAATAGGG - Intronic
1173809908 20:45949333-45949355 CTGGGACTCCTGAAGGAACGGGG + Exonic
1174960669 20:55153716-55153738 CTGGAATGCAAGAAAGAAGAAGG - Intergenic
1176036806 20:63043603-63043625 CAAGGCTTCCTGAAGGAAGAAGG + Intergenic
1176216269 20:63949418-63949440 CTGTCAGTCAAGAAGGAAGACGG + Intronic
1177827635 21:26102032-26102054 TTGGGATTCCAGAAGAATAAAGG - Intronic
1178818738 21:35955526-35955548 CTGAAACTCCAGAGGGAAGAGGG + Intronic
1178832307 21:36066321-36066343 CGGGGATTCCAAAAGGGGGAGGG - Intronic
1178992883 21:37368734-37368756 CTGGGACTCCAGGAGCCAGAAGG + Intronic
1179166092 21:38936376-38936398 ATGTGCTTCCAGTAGGAAGAGGG - Intergenic
1179224223 21:39439195-39439217 CTGGCTTTCAAGATGGAAGAAGG + Intronic
1179297901 21:40079629-40079651 CAGGAACTCCAGAAGGAAGGAGG - Intronic
1180589705 22:16926664-16926686 TTGGGAGTCCGGAAGGGAGAAGG - Intergenic
1181384628 22:22535002-22535024 ATGGGACTCCCGGAGGAAGAAGG - Intergenic
1181887193 22:26030672-26030694 CTGGGATTCCAGAGAGTTGATGG + Exonic
1182376248 22:29850530-29850552 CTTGCATGGCAGAAGGAAGAAGG + Intergenic
1183103672 22:35599503-35599525 CTGAAGTTCCACAAGGAAGAAGG - Intergenic
1183343029 22:37292527-37292549 CTGGGTTTCCGGAGGGAAGGGGG + Intronic
1183579494 22:38715424-38715446 CTGGGCCTGCAGAAGGAGGAAGG - Intronic
1183603182 22:38851837-38851859 CTGCAATTCCAGGAGGAAGGGGG + Intergenic
1184541524 22:45128762-45128784 CTGACCTCCCAGAAGGAAGAGGG - Intergenic
1184690182 22:46113940-46113962 CTGGGCTTCCAGAATGAAAGGGG - Intergenic
1185194381 22:49459703-49459725 AAGGGATTCGAGAGGGAAGAAGG + Intronic
949456909 3:4248684-4248706 CTGGGATTCCAGGTGGAAGCAGG - Intronic
949461783 3:4302549-4302571 CCTGAATTCCAAAAGGAAGAAGG + Intronic
949875131 3:8621522-8621544 ATGACATTGCAGAAGGAAGAGGG + Intronic
950083657 3:10241053-10241075 CTGGCCTTCCAGAAAGGAGAGGG - Intronic
950407637 3:12814631-12814653 CTGGGACTCCAGAAGGGAGAAGG - Intronic
950562592 3:13743385-13743407 CAGGGACTCCAAAAGGAGGAGGG - Intergenic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
952314280 3:32218931-32218953 CTGGGCTTTCAGTAGGGAGAGGG + Intergenic
952719639 3:36519025-36519047 CTGGGATTCCAGAAGGAAGAGGG + Intronic
952878132 3:37965313-37965335 CTGTTTTTCCAGCAGGAAGATGG - Intronic
955059489 3:55483329-55483351 CTGGGATTGAAGAGGGAAGAGGG - Intronic
955195413 3:56801368-56801390 CTGAGAGTCCAGACAGAAGATGG + Intronic
955439360 3:58939333-58939355 CTGGGATTCTAGAAAGGAAAAGG + Intronic
956181312 3:66520396-66520418 CTGGAATTAAAGACGGAAGATGG - Intergenic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
956753876 3:72366834-72366856 CTGGGATTCCATTATGAAAAAGG + Intergenic
957305238 3:78449327-78449349 CCTGAATTCCAAAAGGAAGAGGG - Intergenic
958910678 3:99990799-99990821 CTGGAATTCCATAAAGAAGGTGG + Intronic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959708008 3:109357310-109357332 CTGAGGTTACAGAAAGAAGAGGG - Intergenic
959948355 3:112150535-112150557 CTACAATTCAAGAAGGAAGATGG - Intronic
961514102 3:127422383-127422405 CAGGGCTTCCAGAATGGAGAGGG + Intergenic
961785703 3:129345300-129345322 CTTTGGTTCCACAAGGAAGATGG - Intergenic
962024791 3:131536475-131536497 TTGAGATTCCAAAAGAAAGAGGG + Intronic
962123978 3:132595097-132595119 CTGGGAGTCCAGATGGATGAGGG + Intronic
965537720 3:169841268-169841290 CAGGGCTGCCAGGAGGAAGAAGG - Intronic
965804570 3:172528848-172528870 CTGAGCTTCCAGAATGAAGAGGG + Intergenic
965869300 3:173247429-173247451 CTGGGGTTCCATGAGGAAAATGG + Intergenic
966508781 3:180736951-180736973 CTGAGATTCCAGAATGAGGCAGG + Intronic
966988811 3:185207402-185207424 GGGGGATTCAACAAGGAAGAAGG + Intronic
967236005 3:187384260-187384282 GTGGGATGCTGGAAGGAAGAAGG - Intergenic
967282516 3:187835938-187835960 CTGGGATGGCATTAGGAAGATGG - Intergenic
967426927 3:189338093-189338115 ATAGGATTCCAGAAGAAAGAAGG + Intergenic
968817245 4:2828443-2828465 CTGGGACCCCAGAGGGAAGGAGG - Intronic
969198977 4:5586522-5586544 CTGAAATTCCAAAAGGAAGGAGG - Intronic
969578212 4:8048694-8048716 GTGGGAGTCCAGGAGGAAGCTGG - Intronic
969889210 4:10244018-10244040 CTTGCATTTCAGAAGCAAGATGG + Intergenic
970889869 4:21031072-21031094 CTTGGAGACCAGATGGAAGATGG - Intronic
970960395 4:21864575-21864597 CTGGGATTCCAGAAAATAAAAGG + Intronic
972884771 4:43471894-43471916 CTAAGGTTCCAGAAGGATGAAGG - Intergenic
973074039 4:45900587-45900609 CTGTGAGTCTAGAAGCAAGATGG + Intergenic
974882887 4:67781114-67781136 CTGGAATTCCAAAAGGGAGGAGG - Intergenic
975087829 4:70364882-70364904 CTAGGAATCCAGGAGAAAGATGG + Intronic
975263551 4:72334119-72334141 CTGGGATTACAGGAGAAAGAAGG + Intronic
975581630 4:75912004-75912026 CTGTGAGGCTAGAAGGAAGATGG + Intergenic
975850943 4:78571996-78572018 CTGGGATTCCCCAAGGACAATGG + Intronic
977711361 4:100129626-100129648 CTGAGATTCAACAAGGAGGATGG + Intergenic
978114730 4:105005624-105005646 CTGGAATCCCAGAAGGAAAGAGG - Intergenic
978198588 4:105998442-105998464 CTGGGATTTCTGGAGGAAAAGGG + Intronic
978729859 4:112013096-112013118 CTGGGACACCTGTAGGAAGAAGG + Intergenic
979400789 4:120247038-120247060 GTGGATTTGCAGAAGGAAGAGGG + Intergenic
980740015 4:136938323-136938345 CTGGGAATCAAGAGGGAAGAAGG + Intergenic
981627756 4:146778809-146778831 CCTGGACTCCAAAAGGAAGAAGG + Intronic
982131242 4:152230533-152230555 CTGGGAATCCAGAAGGGCTATGG + Intergenic
982474978 4:155839397-155839419 CTGCCATTCCAGAAGTAGGATGG + Intronic
982666720 4:158273923-158273945 CTGGGATCCCAGAAGACAAAAGG + Intergenic
984031341 4:174607574-174607596 CTGGGGTTCCTTAAGGAAAATGG + Intergenic
984962159 4:185108381-185108403 CCGGAATTCCAAAAGGAGGAGGG + Intergenic
985049226 4:185972788-185972810 CTGGGGCTCCATCAGGAAGAGGG + Intergenic
986044320 5:4022800-4022822 CAGGGAGTCCAGCAGGGAGAAGG - Intergenic
986325451 5:6669978-6670000 CTGGGCTGACAGAAGGCAGAGGG + Intergenic
986428037 5:7654233-7654255 CAGGGTTTCAGGAAGGAAGAAGG + Intronic
986429042 5:7663655-7663677 CTGGTCTTCCAGAAGAAACAAGG - Intronic
986603801 5:9501620-9501642 CCCGGATTCCAGCAGGAGGAGGG - Intronic
987124315 5:14797247-14797269 CTGGGATTCCAGGAGAAATCAGG + Intronic
987126518 5:14818199-14818221 CTGGGCTTCCACATGGAATAAGG - Intronic
987344338 5:16965658-16965680 TTAGAATTCCAAAAGGAAGAGGG - Intergenic
987533299 5:19149676-19149698 CGGGGAATCCAAAAGGAGGAAGG + Intergenic
988177043 5:27742332-27742354 CTTTAATTCAAGAAGGAAGATGG + Intergenic
989112745 5:37922969-37922991 CTGAGAACTCAGAAGGAAGAAGG - Intergenic
989209750 5:38846781-38846803 CTAGGTTTCCAGAATGTAGAGGG - Intronic
991223471 5:64242782-64242804 TTGGGATCCCAGATTGAAGATGG + Intronic
991425508 5:66487890-66487912 CTGGCATTCAAGAAGCAAGGTGG - Intergenic
992227787 5:74635577-74635599 CTGTCCTCCCAGAAGGAAGAGGG + Exonic
995172796 5:109137248-109137270 CTTGGTTTCCAGAAGAAAAAAGG + Intronic
996242472 5:121220964-121220986 CTGGGTTTCAAGAAGAAAGATGG + Intergenic
996343454 5:122464256-122464278 CTGAGATTTGAGAAGGCAGAAGG - Intergenic
996390277 5:122952932-122952954 CTGGGACTCCAGAAAGAAGTAGG - Intronic
996486598 5:124042268-124042290 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
996492301 5:124111943-124111965 CTTTGTTCCCAGAAGGAAGAAGG - Intergenic
997360073 5:133289377-133289399 CTGGGCTTCCTGGAAGAAGATGG - Intronic
997953895 5:138263649-138263671 CCTGGATCCCAGAATGAAGAAGG + Intronic
998172696 5:139881851-139881873 CTGGGGCTTCAGAAAGAAGAGGG - Intronic
999324153 5:150632736-150632758 CAGGGATTCCAAGGGGAAGAGGG - Intronic
999925619 5:156372950-156372972 CTGAGATGCCATAATGAAGATGG + Intronic
1002882312 6:1263706-1263728 TTTGGATTCCAGAGGAAAGAAGG + Intergenic
1003158560 6:3616897-3616919 CTGGGATTCTAGAAGGCACAGGG - Intergenic
1003601142 6:7518675-7518697 CTGGGTTCCCTGATGGAAGAGGG - Intergenic
1004286172 6:14322806-14322828 AGGGGACTCCAGAGGGAAGAGGG + Intergenic
1004423603 6:15492741-15492763 CTGGGTTTCGAGGAGGAAGATGG + Intronic
1004475602 6:15968322-15968344 CTGGGGCTGCAGAAGGAAGATGG + Intergenic
1005696927 6:28360024-28360046 CTGGGATTTCAGGAGGAAACAGG - Intronic
1006793247 6:36717063-36717085 CGGGGGTTCGAGAAGGGAGAGGG + Intronic
1007496323 6:42262309-42262331 CTGGGAATCCAGGAGGCATAAGG - Intronic
1007655787 6:43450302-43450324 CTGGCGTTCCAGATGCAAGAGGG - Exonic
1008650605 6:53557412-53557434 CTGGGGTTCCTTAAGGAAAATGG + Intronic
1009350746 6:62674994-62675016 TTGAGATTCCAGAATAAAGAAGG + Intergenic
1009749142 6:67860967-67860989 CTGGGATTCCTTAAAGAAAACGG - Intergenic
1010582697 6:77618991-77619013 TTGGGAATCCAGATGGAAAAAGG + Intergenic
1010758686 6:79697504-79697526 CTGGCATACCTGTAGGAAGAAGG + Intronic
1010831926 6:80541520-80541542 GTGGGAGGCAAGAAGGAAGATGG - Intergenic
1011265329 6:85512093-85512115 CTGGCCTTCCACATGGAAGAAGG - Intronic
1011400777 6:86959134-86959156 CTGAGTTTCCCCAAGGAAGAGGG - Intronic
1012553080 6:100482016-100482038 CAGGGACTCCAGAGGGAAGCGGG + Intergenic
1012606811 6:101167930-101167952 TGGGGATGCCAGAAGGGAGATGG - Intergenic
1013067505 6:106698092-106698114 CTGTGAGTCTAGAAGCAAGATGG + Intergenic
1013117325 6:107113555-107113577 CTTGGATTCTAGAGGAAAGATGG - Intronic
1013680709 6:112522411-112522433 CTGTGAGGCTAGAAGGAAGATGG - Intergenic
1013817968 6:114121937-114121959 CAGGACTTCCAGCAGGAAGAAGG - Intronic
1014145008 6:117987503-117987525 CTGGGTGTCCTGGAGGAAGAGGG - Intronic
1014322145 6:119943131-119943153 CTTTAATTCAAGAAGGAAGATGG - Intergenic
1014746013 6:125201871-125201893 CTCAGATTTCAGAAGGAAAAAGG + Intronic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1015692243 6:135937926-135937948 CTGGTTTTGCGGAAGGAAGAAGG - Intronic
1015729616 6:136334745-136334767 TTGGGAAGCCAGAAGGGAGATGG - Intergenic
1017198136 6:151724011-151724033 CTGGAATTCTAGAAGGTAGAAGG + Intronic
1018004144 6:159604599-159604621 CTGAGATGCCAGTAGGGAGAAGG - Intergenic
1018538292 6:164848044-164848066 CTGGGACTCCGGAAGGAAGTGGG - Intergenic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1019133706 6:169895504-169895526 CTGAGGTTCCTGGAGGAAGAAGG - Intergenic
1019604615 7:1902171-1902193 CTGTGATTCCAGGAGGAGGCAGG - Intronic
1020223540 7:6261107-6261129 CCAGGATTCCAGAGGGAAAAGGG + Intronic
1020359855 7:7316292-7316314 CTTGGTTTCCATAGGGAAGATGG - Intergenic
1020814024 7:12882243-12882265 CAGGTATTACAGAAAGAAGAGGG + Intergenic
1022050382 7:26662812-26662834 CTGGGTTCCCAGAAAGCAGAGGG + Intergenic
1023968794 7:44977188-44977210 CTGAGAGTGGAGAAGGAAGAAGG + Intronic
1023978933 7:45054662-45054684 CTGGGATTAGTGAAAGAAGACGG - Intronic
1024140450 7:46457916-46457938 CTGAGGTTACAGAAAGAAGAGGG + Intergenic
1024632725 7:51262776-51262798 CTGGGATACAAGGATGAAGAGGG + Intronic
1024999887 7:55307060-55307082 CTGGTATTTCTCAAGGAAGACGG + Intergenic
1025944707 7:66096910-66096932 CTGGTCTTGCAGATGGAAGAAGG - Intronic
1027499523 7:78931338-78931360 CAGTTATTCCAGGAGGAAGAGGG - Intronic
1028275575 7:88852587-88852609 CTTGGATTCCATCATGAAGAGGG - Intronic
1028653126 7:93172428-93172450 CTGGGAGGCTAGAAGCAAGAAGG + Intergenic
1028889172 7:95967666-95967688 CTGGCATTCTAGCAGCAAGATGG - Intronic
1028905811 7:96152801-96152823 CAGGGCTTCCAGAAGTGAGAAGG + Intronic
1028977659 7:96932085-96932107 CTGGGAGTCAAGAATGAAGAGGG - Intergenic
1029002246 7:97166620-97166642 CCTGAATTCCAAAAGGAAGAAGG + Intronic
1029177953 7:98678274-98678296 CTGGCATTGCAGAGGGAAGAAGG + Intergenic
1029530499 7:101122170-101122192 CTGGGATTCCAGAGGGACAGAGG + Intergenic
1029649941 7:101884857-101884879 CGGGGATTCCAGAAGGCAAGGGG - Intronic
1031013728 7:116550247-116550269 CAGGGTTTCAAGATGGAAGAGGG - Intronic
1032429482 7:131849316-131849338 CTAGGAGTCCAAATGGAAGACGG + Intergenic
1032896873 7:136261195-136261217 CTAGGGTTGCAGAAGGATGAAGG + Intergenic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1034782998 7:153898786-153898808 CTGAGATTCCAGTAGAAATAAGG - Intronic
1035814612 8:2526125-2526147 CAGGGATCTCAGAAGGATGAAGG + Intergenic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1037951448 8:23020909-23020931 GTGGGATGCCAGATGGAAGTGGG + Exonic
1038411287 8:27361685-27361707 CTGGGATACCAGAAAGAGAAGGG - Intronic
1039669975 8:39584770-39584792 ATGGGATCCCAGAAGGGAGAGGG - Intronic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1040855982 8:51948302-51948324 CTGGGAGGGCAGAAGCAAGATGG + Intergenic
1041304363 8:56445459-56445481 CTGGGCTGTCAGAAGGAAGATGG - Intronic
1041395382 8:57384804-57384826 CTGGAATCCCAGAGGAAAGAGGG + Intergenic
1041957108 8:63568450-63568472 CAGGAATTTCTGAAGGAAGATGG - Intergenic
1042083995 8:65088374-65088396 GTGAGTTTCCAGAAGCAAGAAGG + Intergenic
1042374852 8:68038642-68038664 CTGGGATTCTTGAAGGAAGAGGG - Intronic
1042508376 8:69585442-69585464 CTGGGATTCCAGGAACAATATGG - Intronic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1043598483 8:81912460-81912482 CGGGGACTCCAAAAGGAAGGAGG - Intergenic
1045410033 8:101907937-101907959 CTGGGATTCCACAAGGGAGTAGG + Intronic
1045501756 8:102749015-102749037 CAGGGATCCCAGAGGGAAGCAGG + Intergenic
1045705728 8:104920375-104920397 CTGGGGTCCCAGAAGGATGTGGG + Intronic
1045942513 8:107755420-107755442 ATGGGAAGCCAGAAGGGAGATGG - Intergenic
1046250460 8:111624234-111624256 TGGGGAAGCCAGAAGGAAGATGG + Intergenic
1046917045 8:119688978-119689000 CTGGGATTCAAGAAGGAGTCAGG + Intergenic
1048263988 8:132969123-132969145 GTGGGATTCCAGAGGGCAGATGG + Intronic
1049648691 8:143752293-143752315 CTTGGAGGCCAGAAGGCAGAGGG - Intergenic
1049735883 8:144204378-144204400 CTGGGATTACAGAAGTGAGATGG + Intronic
1049950013 9:634741-634763 CTGTGAGGCCAGAAGCAAGATGG + Intronic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1053280134 9:36815133-36815155 CTGGCATTGCAGCAGGAAGAAGG + Intergenic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053415939 9:37946765-37946787 CGGGGATTCCAGGAGGAATGAGG + Intronic
1053661799 9:40288964-40288986 CTGGAATTCCAAGATGAAGATGG - Intronic
1053792556 9:41697041-41697063 CTGGGAATCCAGGGCGAAGAAGG + Intergenic
1053912174 9:42918308-42918330 CTGGAATTCCAAGATGAAGATGG - Intergenic
1054152618 9:61617779-61617801 CTGGGAATCCAGGGCGAAGAAGG - Intergenic
1054180969 9:61909062-61909084 CTGGGAATCCAGGGCGAAGAAGG + Intergenic
1054373924 9:64435200-64435222 CTGGAATTCCAAGATGAAGATGG - Intergenic
1054522810 9:66087320-66087342 CTGGAATTCCAAGATGAAGATGG + Intergenic
1054656622 9:67672080-67672102 CTGGGAATCCAGGGCGAAGAAGG - Intergenic
1055151885 9:73010331-73010353 CTGGGAGTGCTGAAGGAAGCCGG + Intronic
1055223095 9:73962735-73962757 CTGGGTCTCCAGATGGCAGATGG - Intergenic
1055379702 9:75692782-75692804 CAGGGAATACAGAAAGAAGATGG - Intergenic
1055657171 9:78462523-78462545 AAGGGATTGCAGAAAGAAGAAGG + Intergenic
1055686993 9:78786010-78786032 CTGGGAGTCCAGAATGAACAAGG + Intergenic
1056055952 9:82824294-82824316 CTGGGATTATAGGGGGAAGAAGG + Intergenic
1056202247 9:84288179-84288201 CTGCAATTTCAGAAGAAAGAAGG + Intronic
1056329669 9:85511067-85511089 CTAGGATGCAAGATGGAAGAGGG - Intergenic
1056408800 9:86303970-86303992 CTGGGAGTACAGAGGGAATAGGG + Intronic
1058547867 9:106080432-106080454 CTGGGATGAAAGATGGAAGAGGG + Intergenic
1058585897 9:106505805-106505827 CTGGCTTTGCAGAAGGAGGAAGG - Intergenic
1058621584 9:106888867-106888889 TTGAGGTTCCAGAAGGAACATGG - Intronic
1058636556 9:107043960-107043982 CCAGCATTCCAGAAGGAACAGGG - Intergenic
1059164046 9:112062060-112062082 CTGGGATTCCAGATGGCATTAGG - Intronic
1059175940 9:112170281-112170303 CTGTGATTCCTGAAGACAGAGGG + Intronic
1059285117 9:113165845-113165867 CTGGGATTTCAGCAGCAAGTTGG - Exonic
1059319076 9:113452614-113452636 CTGGAATCCCAGAAGAAAGTAGG - Intronic
1059489631 9:114656459-114656481 CTGGGCTTCCATGAGGAAGAGGG - Intergenic
1059603357 9:115805928-115805950 TGGGGATTCCAGAAGGGGGAAGG + Intergenic
1059696749 9:116737010-116737032 CTGAGCTTCCAGAAAGTAGAGGG + Intronic
1060921313 9:127422494-127422516 CTGAGGTGGCAGAAGGAAGATGG - Intergenic
1061318418 9:129812500-129812522 CTGGGAAGCCATAAGGCAGAGGG + Intergenic
1062008795 9:134256146-134256168 AGGGGATTCCAGAAGGAAGGGGG + Intergenic
1185535886 X:861377-861399 CTGGGATTCCCGGAGCAGGAGGG - Intergenic
1185644349 X:1606585-1606607 TTGGAATTCCAGAGGGAAGGAGG + Intergenic
1186425411 X:9460956-9460978 CAGGGGTTCAAGGAGGAAGAAGG - Intergenic
1186490822 X:9970602-9970624 CAGAGATTCCTGTAGGAAGAAGG - Intergenic
1186940295 X:14499685-14499707 CTGGGACTCCAAAAGGCAGGAGG + Intergenic
1187081913 X:15998949-15998971 ATGGGATTTCACAAGGAGGAAGG - Intergenic
1187274891 X:17808569-17808591 CTGGGAAGTAAGAAGGAAGATGG - Intronic
1188410882 X:29870776-29870798 TTGGTATTCCATAAGCAAGAAGG + Intronic
1189189300 X:39084118-39084140 CTTGGAGGCCAGAAGGAAGTGGG + Intergenic
1189233537 X:39470635-39470657 TTTGGATTCATGAAGGAAGAGGG - Intergenic
1189368125 X:40405626-40405648 CAGTGAATCCAGAAGGAAAAAGG - Intergenic
1190980699 X:55454730-55454752 CTGGATGTCAAGAAGGAAGAAGG - Intergenic
1190987998 X:55518450-55518472 CTGGATGTCAAGAAGGAAGAAGG + Intergenic
1192386445 X:70676684-70676706 CTGGGATTCCCAAATGAGGATGG - Intronic
1194262230 X:91710520-91710542 CAGTAATTCCAAAAGGAAGAAGG + Intergenic
1196006649 X:110843901-110843923 TGGGGAGGCCAGAAGGAAGATGG - Intergenic
1196260932 X:113580511-113580533 CTTGTAGTCCAGAAGGAAGAGGG - Intergenic
1196630527 X:117934122-117934144 CTGGGATTCTAAAAGGAGGAAGG + Intronic
1196649050 X:118150202-118150224 CTTGGAGGCCAGAAGCAAGATGG - Intergenic
1197290372 X:124649037-124649059 GAGGGACTCCAGGAGGAAGATGG + Intronic
1198013360 X:132583169-132583191 CTGGGAACCAAGAAGCAAGAAGG + Intergenic
1198401082 X:136268976-136268998 CTAGGATTCCAGCTGGGAGAGGG - Intergenic
1200581526 Y:4955353-4955375 CAGTAATTCCAAAAGGAAGAAGG + Intergenic
1200910060 Y:8523971-8523993 ATGGGGAGCCAGAAGGAAGATGG - Intergenic
1201291390 Y:12423679-12423701 CTGGGACTCCATAATGAAGATGG - Intergenic
1201351334 Y:13045671-13045693 CTGGGATTACAGACGGAATGTGG - Intergenic
1201677747 Y:16605960-16605982 CTGGAATCCCAGAAGGAAAGGGG + Intergenic