ID: 952720466

View in Genome Browser
Species Human (GRCh38)
Location 3:36526915-36526937
Sequence CTATCCTAATAGCTGTAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952720466_952720471 -10 Left 952720466 3:36526915-36526937 CCTTGCTACAGCTATTAGGATAG 0: 1
1: 0
2: 0
3: 8
4: 104
Right 952720471 3:36526928-36526950 ATTAGGATAGGAGGAGGAGGCGG 0: 1
1: 0
2: 7
3: 132
4: 1279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952720466 Original CRISPR CTATCCTAATAGCTGTAGCA AGG (reversed) Intronic
904998669 1:34650995-34651017 CTATCCAAACAACTGTAGCCAGG - Intergenic
907827426 1:58032379-58032401 CTATCTCAAAAGCTGTTGCATGG + Intronic
908781781 1:67697607-67697629 CTATCTTAATATTTGTAGTATGG - Intergenic
910270833 1:85392187-85392209 CTTTCCTCATAGCCTTAGCAAGG - Intronic
910606833 1:89095279-89095301 CTTTCCTAATTGCTCTAGCAAGG - Intergenic
911548821 1:99254832-99254854 CTATCAAAAGAGCTGAAGCAAGG - Intergenic
911885903 1:103299284-103299306 CTATCCTTATAGCTGGGGGAGGG - Intergenic
914996118 1:152544606-152544628 TTCTCCTAATAGCTGTGTCAAGG + Intronic
915002597 1:152607297-152607319 TTCTCCTAATAGCTGTATTAAGG - Intergenic
918199096 1:182250054-182250076 CTAGACTAATAGGTGTACCAAGG - Intergenic
918918996 1:190681117-190681139 CTATTATATTAGATGTAGCATGG - Intergenic
920731731 1:208492930-208492952 CTTGCCTGATAGCTCTAGCAAGG + Intergenic
922014134 1:221626136-221626158 CTTGCCTAATTGCTGTAGCTAGG + Intergenic
1064245598 10:13665614-13665636 CTATCCCAAGAGCTGAAGCTTGG - Intronic
1069250895 10:66265435-66265457 CTATTGTAATAGCTTTAACAGGG - Intronic
1074804433 10:117034175-117034197 CTAATCTAATTGCTGTAGCTAGG - Intronic
1075629173 10:123990687-123990709 CTTACCTAATTGCTGTGGCAGGG + Intergenic
1080019204 11:27542219-27542241 CTATTCTAATAGATGTGCCATGG - Intergenic
1080167290 11:29254520-29254542 CTTTACTGATAGCTTTAGCATGG + Intergenic
1080972552 11:37295701-37295723 CTATCACAAAAACTGTAGCATGG - Intergenic
1086192080 11:84091883-84091905 CTATCTTGCTAGCTGTAGCCTGG + Intronic
1096755297 12:53794312-53794334 CTTTCCTAATAGATGGGGCAGGG + Intergenic
1098457802 12:70695128-70695150 CTATCCATATATCTGTTGCAAGG + Intronic
1098832509 12:75379311-75379333 CTCTGCTCATAGCTTTAGCATGG - Intronic
1099173526 12:79394060-79394082 CTAACCTAGAAGCTATAGCAGGG + Intronic
1099922971 12:88981936-88981958 CTATCACTTTAGCTGTAGCATGG - Intergenic
1103334068 12:120176065-120176087 TTGTCCTAATTGTTGTAGCAGGG - Intronic
1105387128 13:19941450-19941472 CTATCCTAATAGTGTGAGCAGGG + Intergenic
1105468344 13:20668497-20668519 CCATTGTAATAGCTGTAGCAAGG - Intronic
1105682824 13:22746625-22746647 CTACCCTATCAGCTGTAGCGTGG + Intergenic
1105890333 13:24678014-24678036 CTGTCCCAATAGTTGGAGCAGGG + Intergenic
1106927257 13:34626088-34626110 CTATCCTGGTACCTCTAGCATGG + Intergenic
1107994263 13:45845563-45845585 ATATACTAACAACTGTAGCATGG - Intronic
1108022258 13:46139612-46139634 CTATACTAATAGCTCTGACAAGG - Intronic
1110391322 13:74978087-74978109 CTATTCACACAGCTGTAGCAAGG + Intergenic
1112256362 13:97835595-97835617 ATATCCTAATGGCTGTATGATGG + Intergenic
1116819854 14:49617320-49617342 CCTTCCTAGTAGCTGTAGCTAGG - Intergenic
1117950616 14:61079675-61079697 CTTTCCTAAAGGCTGTCGCAGGG - Intronic
1126383837 15:48074141-48074163 CTATACTGACAGCTGTAACAGGG + Intergenic
1128713413 15:69889018-69889040 CTAACCTGAGAGCTGAAGCATGG + Intergenic
1129123337 15:73417097-73417119 CTATCCTAATGGGTGTAACATGG - Intergenic
1129553818 15:76483796-76483818 CCATCCTAATAGGTGTATAATGG - Intronic
1129638013 15:77343165-77343187 CTATCCTAATAGGTGTAAAGTGG + Intronic
1131089561 15:89612507-89612529 CTATCCCAATAGCTACAGCAGGG + Intronic
1134088699 16:11377339-11377361 CTTTCTTAATAGCTCTAGCTAGG + Intronic
1140176990 16:72671939-72671961 CTATCCCCATGGCTGCAGCAGGG - Intergenic
1146612556 17:34320578-34320600 CTAACCCAATATCTGTAGCCAGG + Intronic
1154143561 18:11847209-11847231 CTTTCCTATTAGGTGTGGCATGG - Intronic
1157977860 18:52346051-52346073 ATATCATAATATCAGTAGCATGG + Intronic
1164011045 19:21203674-21203696 CTCTCCTAATAGCTGAGGAATGG - Intergenic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
926522633 2:13934595-13934617 CTTTCCTAACATCTGTTGCAAGG + Intergenic
926600763 2:14843309-14843331 CTTGCCTAATTGCTGTAGCCAGG - Intergenic
929349919 2:40938207-40938229 CTACCCTAATTACTGTAGCCTGG - Intergenic
930990639 2:57650214-57650236 CTTTCCTAATTGCTCTAGCTAGG + Intergenic
932038379 2:68271575-68271597 ATATCCTATTAGCTGCATCATGG - Intergenic
932388618 2:71362980-71363002 TTATGCTAATAGGTGTATCAGGG - Intronic
941861713 2:170288716-170288738 CTTTCCTAATTGCTCTGGCAGGG + Intronic
943987235 2:194638967-194638989 CTAGCCTAATTGCTCTAGCTAGG - Intergenic
945512944 2:210725235-210725257 CTGAACTAATAACTGTAGCAAGG + Intergenic
947495173 2:230630564-230630586 TTATTCTAATAGCTGTATAAAGG - Intergenic
1169653758 20:7898795-7898817 CTGTCCTAATAGACATAGCATGG + Intronic
1172881187 20:38200967-38200989 CTATCCTAGCAGCTGCAGCCAGG + Intergenic
1174732940 20:52935899-52935921 CTATCCGAATAGCTGTTTCTAGG - Intergenic
1177002401 21:15630557-15630579 CTATCCTAATAGGTGTAAAATGG - Intergenic
1177859675 21:26438098-26438120 CTTTCCTAAAGGCTGCAGCATGG + Intergenic
1178992045 21:37365221-37365243 ATGTCCTAGTAACTGTAGCAAGG + Intergenic
951500865 3:23385421-23385443 CTATCCAAGCAGCTGTGGCATGG - Intronic
952720466 3:36526915-36526937 CTATCCTAATAGCTGTAGCAAGG - Intronic
953230500 3:41060936-41060958 CTTTCCTGATTGCTGTGGCAGGG + Intergenic
954642718 3:52111293-52111315 CTACCCTAATCGCTGTTTCAGGG + Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
954910783 3:54105801-54105823 TCACCCTAAAAGCTGTAGCAGGG + Intergenic
957958899 3:87225063-87225085 CCAACCTAATAGCTGTTGCAAGG - Intergenic
958562335 3:95762762-95762784 CTATCTTAATAGCTTATGCAGGG + Intergenic
959483319 3:106899502-106899524 CTAGCACAATAGTTGTAGCAGGG + Intergenic
960841207 3:121961514-121961536 CTTTTCTAATTGCTGTAGCTAGG - Intergenic
962899864 3:139752330-139752352 CTTGCCTAATTGCTCTAGCAAGG - Intergenic
965583139 3:170290832-170290854 GTATTTTAATAGCTGTAGGATGG - Intronic
975174423 4:71270992-71271014 CTGTCCAAAAAGCTATAGCAGGG - Intronic
976271831 4:83238261-83238283 CTTGCCTAATTGCTGTAGCTAGG + Intergenic
977386506 4:96347030-96347052 CCATCCTAATAGGTGTATAATGG - Intergenic
978068472 4:104436101-104436123 CTAAGCTAAGAGCTGGAGCATGG - Intergenic
980449927 4:132958307-132958329 CCATCGTACTAGCTGCAGCAGGG + Intergenic
980853839 4:138415306-138415328 GTATCATAATAGCTATGGCAGGG + Intergenic
988274867 5:29068436-29068458 CTATCATAATAACAGCAGCATGG + Intergenic
995535965 5:113136856-113136878 CTTTCCTAATTGCTCTAGCCAGG + Intronic
998508153 5:142688875-142688897 CTCTCCTAAGAGCTTTAGAAGGG + Intronic
1003593883 6:7457609-7457631 CTATATTAACAGCTGTAACACGG + Intergenic
1004972147 6:20922475-20922497 CTATCCTACTAGATGTACAATGG - Intronic
1008533752 6:52490523-52490545 CTTTTCTAATTGCTGTTGCAGGG + Intronic
1012077943 6:94717324-94717346 CTTTTCTAATTGCTCTAGCAAGG - Intergenic
1013417187 6:109935582-109935604 CTATCATGAGAGCAGTAGCATGG + Intergenic
1014720640 6:124913586-124913608 CTATCCTAATGGGTGTAACATGG + Intergenic
1018348631 6:162930590-162930612 CTTACCTAATTGCTGTAGCCAGG + Intronic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1024480234 7:49855085-49855107 CTATCTTCACAGCTGTACCAAGG - Intronic
1028778548 7:94707115-94707137 ATAACATAATAGCTGTAACATGG + Intergenic
1030243433 7:107355216-107355238 CTATTCTAATAGGTGTGTCATGG - Intronic
1030731287 7:112992407-112992429 CTTGCCTAATTGCTGTAGCTAGG - Intergenic
1041438293 8:57865659-57865681 CCATCCTAATAGATGTGACATGG + Intergenic
1046242972 8:111522839-111522861 CTTTTCTAATAGCTGTGGCTAGG + Intergenic
1052609574 9:30755900-30755922 CTTTCCTAATGTCTGTAGCTAGG - Intergenic
1056192923 9:84202517-84202539 CCATTCTAATAGGTGTACCATGG - Intergenic
1056482955 9:87024375-87024397 CTATCCTAAGAGCAGTACCAAGG + Intergenic
1060907465 9:127319878-127319900 ATACCCTCATAGCTGGAGCAAGG + Intronic
1061357195 9:130115283-130115305 CTATCCAAATCACTGTAGAAGGG - Intronic
1188252397 X:27913598-27913620 CTGTCCTTGTAGCTGTGGCAGGG - Intergenic
1189360441 X:40345981-40346003 CTTGCCTAATTGCTGTAGCTAGG + Intergenic
1192399437 X:70819576-70819598 CTTTCCTAATTGCTGTTGCTGGG - Intronic
1198588502 X:138149596-138149618 CCATGCTAATATCTTTAGCAAGG - Intergenic
1198627449 X:138593622-138593644 CTATCCTCATAGCAGAAGAAAGG + Intergenic
1198980830 X:142393757-142393779 CTTTCCTAATTGCTCTAGCTGGG + Intergenic