ID: 952722651

View in Genome Browser
Species Human (GRCh38)
Location 3:36549292-36549314
Sequence CTGCAGAAATTAAAAGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 470}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952722649_952722651 2 Left 952722649 3:36549267-36549289 CCACAGCTTTTTTTTTCTTGCCT 0: 1
1: 0
2: 20
3: 233
4: 2149
Right 952722651 3:36549292-36549314 CTGCAGAAATTAAAAGCACAAGG 0: 1
1: 0
2: 1
3: 41
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952722651 Original CRISPR CTGCAGAAATTAAAAGCACA AGG Intergenic
900687394 1:3957436-3957458 CTCCAGAAATGACAAGCTCAGGG - Intergenic
901256448 1:7832183-7832205 CTACAGACATTAAAAGGAAAAGG - Intronic
902954764 1:19917980-19918002 CTGCAGAAACAGAAAACACAGGG - Intergenic
903199838 1:21726239-21726261 CTGCAGGAATTCAAAGCCTAGGG + Intronic
903216259 1:21844900-21844922 GTCCAGTAATTAATAGCACAGGG - Intronic
903465790 1:23552074-23552096 CTGCAGACATCCAAAGCACTGGG + Intergenic
904285245 1:29449751-29449773 CTGCAGAACCTCAAAGCTCAAGG + Intergenic
905191564 1:36239202-36239224 CTACAGAAAATAAAAAAACACGG - Intronic
906023278 1:42650550-42650572 CTACAGTAATTAAAACAACATGG + Intronic
906176724 1:43780663-43780685 CAGCAGAAATAAAAAGGACCTGG - Intronic
906222530 1:44092911-44092933 ATTCAAAAATTAAAAGCAAATGG + Intergenic
906464553 1:46064666-46064688 ATTTAGAAATTAAAAACACAAGG + Intronic
907113797 1:51950848-51950870 CTGCAGAAAAACAAAGCACTTGG - Intronic
907488669 1:54794881-54794903 CTGCAGAAATAAAAGTCACAAGG + Intronic
908837480 1:68242354-68242376 CTGGAGAAAGCAAAAGGACAAGG + Intergenic
908927697 1:69276099-69276121 CAACAGAAATTAAATACACAAGG + Intergenic
910922626 1:92365476-92365498 CTGCACAAATTAGAATCACTTGG - Intronic
911393693 1:97278407-97278429 CTACAGAAAGTAAATGGACAGGG + Intronic
911437091 1:97875042-97875064 ATGCAGAAATGAAAATCAAATGG + Intronic
911837678 1:102642104-102642126 CTGTAGTAGTTAAAATCACATGG - Intergenic
911890116 1:103357890-103357912 CTCCAAAAATTAAAATCACTAGG + Intergenic
912309046 1:108600816-108600838 CTGCAGTAATTAAAATACCATGG + Intronic
913377294 1:118166516-118166538 CAGTAAAACTTAAAAGCACAGGG + Intronic
914328333 1:146642820-146642842 CAGCAGGAAATAAAAACACAGGG + Intergenic
915025807 1:152828336-152828358 CTGAAGAAGTCCAAAGCACAAGG - Intergenic
915117457 1:153609660-153609682 ATGCAGAGATTAAAAGCAGGGGG - Intronic
915699129 1:157774091-157774113 CAGCAAAAACTAAAAGCAAATGG + Intronic
916014291 1:160735247-160735269 GTGCAGAAATCCACAGCACATGG - Intergenic
917060894 1:171037708-171037730 CTTTAGTAATTAAAATCACATGG + Intronic
917766098 1:178219091-178219113 CTCCAGAACATAAAAGTACAAGG - Intronic
917910854 1:179643905-179643927 CTGCTGAAATCTAAAGCAAAAGG + Intronic
918433346 1:184485017-184485039 ATTCAGAAATTAAAAGCACTTGG + Intronic
919516117 1:198526111-198526133 CTGCAGAAACTCAAATCACTGGG - Intronic
919545671 1:198915091-198915113 CTGCAAAAATTAATACTACATGG + Intergenic
921467566 1:215507799-215507821 CTGCAGAAATTCAAAATGCAGGG + Intergenic
922024992 1:221741746-221741768 CTGCAGGGAGTAAACGCACAGGG + Intronic
922964199 1:229674377-229674399 CTGCAGACTATAAAATCACATGG + Intergenic
923685881 1:236153310-236153332 CTGCAGAGATAGAAAGCAGATGG - Intronic
923919123 1:238544477-238544499 GTGTAGAAATTATAAGCATAAGG - Intergenic
924620402 1:245655187-245655209 ATGGAGAAATGAAAAGCTCAGGG - Intronic
924647209 1:245889286-245889308 CTATAGAAATTAAGAGAACATGG - Intronic
1063293243 10:4773441-4773463 CTGCAGAAAATGGAAGCAGAAGG + Intergenic
1063750316 10:8936623-8936645 GAGCACAAATTAAAATCACAAGG - Intergenic
1064159963 10:12936930-12936952 CTAAAGAAATAAAAAACACAAGG + Intronic
1064281506 10:13955530-13955552 CTGCAGAAAAGAAATGCCCAGGG - Intronic
1064283686 10:13973308-13973330 ATGCATAAATTCAAAGCAAAAGG - Intronic
1065865522 10:29911675-29911697 CTGGAGAAATTACTAGCACACGG - Intergenic
1066057662 10:31696935-31696957 CTGCAAAAAATAAAAGAGCATGG + Intergenic
1066171549 10:32853558-32853580 ATGCTGACATTAAAAGCAGAAGG - Intronic
1066565019 10:36712725-36712747 TTGAAGAAATAAAAATCACATGG + Intergenic
1067315965 10:45162996-45163018 TAGCTAAAATTAAAAGCACATGG + Intergenic
1067671566 10:48327617-48327639 TTGCAGAAAATAAAAACAGAAGG - Intronic
1068122946 10:52803490-52803512 CTGCAGTTCTTAACAGCACATGG + Intergenic
1068215364 10:53976147-53976169 CTGCAGTAATCAAAACAACACGG - Intronic
1070367147 10:75748556-75748578 TTGTAGAAATGAGAAGCACAGGG - Intronic
1070470079 10:76769930-76769952 TTTCAGAAAATTAAAGCACAGGG + Intergenic
1070687144 10:78494736-78494758 CTGCAGACATTAAAATGATAAGG + Intergenic
1071249960 10:83807515-83807537 CTGCAGCATTGAAAAGCAAATGG + Intergenic
1071782732 10:88864480-88864502 GTGTAGAAATTAAAAGCACATGG + Intergenic
1071919536 10:90333912-90333934 CTGCAGAAATATGAAGCTCAAGG + Intergenic
1072119528 10:92394288-92394310 CAGCAAGATTTAAAAGCACAAGG - Intergenic
1072268601 10:93754027-93754049 CTGCAGACATCAAAGGCACTGGG - Intergenic
1072318472 10:94225865-94225887 CTGCAGGAAATAAGAGCTCAAGG - Intronic
1073885907 10:108039461-108039483 GTCCAGAAATTGCAAGCACAAGG + Intergenic
1073985980 10:109209658-109209680 CTGCAGAAAGTAGATGGACAAGG + Intergenic
1074890944 10:117736180-117736202 CTGCAGAGAACAAAAACACAAGG - Intergenic
1075803670 10:125169840-125169862 CTGCAGAGCTGAAGAGCACAGGG - Intergenic
1075883914 10:125880090-125880112 CTACTGAAATCAAAAGCACAAGG - Intronic
1076486964 10:130827984-130828006 CTCCAGAAAATAGAAGCAGAGGG + Intergenic
1076575842 10:131466786-131466808 CTACAGAAATCAAGACCACATGG - Intergenic
1079645254 11:22856125-22856147 TTGCAGAAAATAGAAGCAGAGGG + Intronic
1080450935 11:32378379-32378401 GTGCAGGAATTAAAAGGACAGGG - Intergenic
1080463953 11:32479811-32479833 CTGAAGAAAGCAAAAGCGCAGGG - Intergenic
1080464564 11:32484785-32484807 CTGAAGAAAGCAAAAGCGCAGGG + Intergenic
1081094187 11:38911550-38911572 CTTCAAAAATTCAAAGGACAGGG + Intergenic
1081149462 11:39609079-39609101 CTTCTGAAAACAAAAGCACATGG - Intergenic
1082729708 11:56780321-56780343 CTGCAGAAATAAAAGCCACATGG - Intergenic
1084229093 11:67737835-67737857 ATGCATAAATTAAAGGCAAAGGG - Intergenic
1084841356 11:71853013-71853035 CTGCAGAAACCAAAACAACATGG + Intergenic
1086410205 11:86537600-86537622 CTGCAGAAATGCAGAGCTCAAGG + Intronic
1086587825 11:88476298-88476320 CTGCCCAAATTAAAACTACATGG - Intergenic
1086846288 11:91753949-91753971 CTGAAGAAACTAAAATTACAGGG - Intergenic
1087008178 11:93489104-93489126 CTGCAGTAAACAAGAGCACAGGG + Intronic
1087058976 11:93960098-93960120 CTGGAGAAATAAAAAGCCAAGGG + Intergenic
1087369883 11:97270161-97270183 CTGCAGAATTTCAAAGAAAAAGG + Intergenic
1088073162 11:105814423-105814445 GTGCAGAAATTAAAATGATATGG + Intronic
1088751649 11:112847091-112847113 CTGCAGAAAATAAGAGCTAAAGG + Intergenic
1088895460 11:114074913-114074935 CTGCATAAATCAAAAGTTCAAGG - Intronic
1089306268 11:117528273-117528295 CTGCAGAATTTACAAGCGGAGGG + Intronic
1090237812 11:125162698-125162720 CTCCAAAAATTAATAGCTCATGG + Intergenic
1090413841 11:126527286-126527308 CTGCAGAAAAGAAAGGGACAGGG - Intronic
1090909635 11:131107088-131107110 ATGAAGACATTAAAAGTACAAGG - Intergenic
1092004593 12:5058617-5058639 CTGCAGAAACTCAAAGGACATGG - Intergenic
1093594159 12:20941541-20941563 CAGCAGTGATTAGAAGCACAAGG + Intergenic
1093594193 12:20941792-20941814 CAGCAGAGATTAGCAGCACAAGG - Intergenic
1093766594 12:22970411-22970433 CTCAAGAAATTATAATCACATGG - Intergenic
1093984292 12:25511868-25511890 CAGTACATATTAAAAGCACAAGG - Intronic
1094071562 12:26420463-26420485 CTTCAGAAATTGAAAGGAAAAGG - Intronic
1094738660 12:33263493-33263515 CTGCATAAATGAAAACAACATGG - Intergenic
1094807046 12:34104993-34105015 ATGAAAAAATTAAAAGCCCATGG + Intergenic
1097521435 12:60675561-60675583 CTGCAGTAATTAAAACAACAGGG - Intergenic
1099412945 12:82354086-82354108 TTGAAGAAAGTAAAAGCAAAGGG - Intronic
1099453948 12:82841918-82841940 ATGCAGAAATTAAAAGAATATGG + Intronic
1100026288 12:90132529-90132551 CTGCACAATTTAAAATCACTGGG + Intergenic
1100169267 12:91955170-91955192 CTCCATAACATAAAAGCACAAGG + Intergenic
1100195902 12:92244071-92244093 CTGAAGAAAATAAAAGCTCATGG - Intergenic
1100221382 12:92508030-92508052 CTACAGAAAATAAAAAAACATGG - Intergenic
1100767757 12:97886600-97886622 CTGCAGAAATGGTAAGCATATGG + Intergenic
1101134682 12:101730244-101730266 CTGCAGAAGTAAAAATTACAGGG + Intronic
1101159124 12:101955648-101955670 CTGCTGAAATTAAAGGGACAGGG + Intronic
1101793888 12:107955335-107955357 CTGAAGAAGATAAAAGAACAGGG - Intergenic
1101844885 12:108355392-108355414 CTGAAGAAAGAAAAAGCAAATGG + Intergenic
1102885317 12:116517415-116517437 CTGCAGAACTTCAAAGCTGAAGG - Intergenic
1104315319 12:127694206-127694228 CAGCAGAAAATAAAAGCAACTGG - Intergenic
1104315765 12:127699325-127699347 CTGGAGAAATTAAACTGACATGG + Intergenic
1104509297 12:129361454-129361476 CTGCAGAAATAAAGGGCAAATGG + Intronic
1105964622 13:25372713-25372735 CTGCAGAGCTCAAAAGCAGAGGG + Intronic
1106045744 13:26139513-26139535 CTCCATAAATTAAAATCCCACGG + Intronic
1107092911 13:36501957-36501979 CTACAGAAATAAAAACAACATGG - Intergenic
1107619592 13:42212616-42212638 CTGCAAAATTTAAAAACAGATGG - Intronic
1108369593 13:49754714-49754736 TTGCAGACATCAAAAGAACAAGG + Intronic
1108560907 13:51642982-51643004 GTGCAGCAATTAAAGACACATGG - Intronic
1109381693 13:61569581-61569603 CTGCAGTAATCAAAACAACATGG + Intergenic
1109937317 13:69305833-69305855 CTGCCAAAATTAAAAGAAAATGG - Intergenic
1110028882 13:70579866-70579888 CTAGAGAAATGAAAAGCAAATGG + Intergenic
1110365632 13:74681907-74681929 CTGCAGAAGATAACAGCTCAGGG - Intergenic
1110561503 13:76914977-76914999 CTTCAGAAATTCAAAGAATATGG + Intergenic
1111247145 13:85554550-85554572 GTACAGTGATTAAAAGCACAGGG - Intergenic
1111689246 13:91540556-91540578 CTGCAGACATTAAAAGCCTTTGG + Intronic
1112144922 13:96688481-96688503 ACGCAGCAATTAAAAGCAGAAGG - Intronic
1112161592 13:96874052-96874074 CTGCAGAAACAAAAAGGAGAGGG + Intergenic
1112192773 13:97193932-97193954 TTGCAGAAACTAAAAGACCAGGG - Intergenic
1113005117 13:105692390-105692412 CTGCAAACATTAAATGGACAAGG + Intergenic
1113828773 13:113277811-113277833 CTGAAGAAGATAAAAGCAAACGG - Intergenic
1115167212 14:30462673-30462695 CTGAAAAAACTAAAATCACAAGG + Intergenic
1115499134 14:34033995-34034017 TTGCAAAAATTAAAAGTAGAGGG + Intronic
1117021578 14:51576152-51576174 CTGCAGAAACTAGAGGCACAAGG + Intronic
1118334981 14:64845587-64845609 CTGTAGAGATGAAAAGCAAAAGG + Intronic
1118650767 14:67891693-67891715 CTGCATAAATTAAACCCACTTGG - Intronic
1118946353 14:70391156-70391178 CTGCAGAGATTTTATGCACAAGG - Intronic
1119896820 14:78226957-78226979 CTGCAGTAATTAAATGCATTTGG - Intergenic
1120419870 14:84270528-84270550 CTTTAAAAATTAAAAGCAAATGG + Intergenic
1121021006 14:90580088-90580110 GTGCAGAAAATCAGAGCACAGGG - Intronic
1121071082 14:91022160-91022182 ATGAGGAAATTAAAAGCAAATGG - Intronic
1121399187 14:93657242-93657264 GTGCACAAATTTTAAGCACATGG + Intronic
1202836698 14_GL000009v2_random:83041-83063 AAGCAGAAATTAAAAGCAGCTGG - Intergenic
1124196439 15:27634731-27634753 CTTCTGATATTAAAAGTACAAGG - Intergenic
1124710038 15:32001205-32001227 CTGCAGAAATTAAAAGACAAGGG + Intergenic
1126468775 15:48984883-48984905 CTGCAAAAGTTACAAGTACATGG + Intergenic
1126552053 15:49942434-49942456 CAGCAGAAAATAAAATAACATGG + Intronic
1126576591 15:50203274-50203296 CTGCAGAAGTTTAAAGCTGATGG - Intronic
1127342228 15:58059358-58059380 TTCCAGAAAGTAAAAGCACCAGG - Intronic
1127417805 15:58774047-58774069 CTGCAGAAATTCAGAGGAAAGGG + Intronic
1127785669 15:62352743-62352765 CTTCCAAAGTTAAAAGCACAAGG + Intergenic
1129965815 15:79734461-79734483 CTGCAAAAATTAAATGGGCATGG + Intergenic
1130356100 15:83131710-83131732 CTTCAGAAATCAAAAGATCAAGG + Exonic
1130764159 15:86853016-86853038 CTGCTGCAATTAGAATCACATGG + Intronic
1131669665 15:94606460-94606482 CTGCTGATGTTAAAAGGACATGG + Intergenic
1131831512 15:96357602-96357624 CTACAGAAAATAAAAGGAAAAGG - Intergenic
1134561288 16:15212225-15212247 ATTCAGAAATTACAAGCGCACGG - Intergenic
1134855992 16:17519643-17519665 CTGCAAAAATGAAAAGAAGACGG + Intergenic
1134921826 16:18123845-18123867 ATTCAGAAATTACAAGCGCACGG - Intergenic
1135425746 16:22334305-22334327 CTGCAAACATTAAAAGGAGATGG - Exonic
1136281549 16:29214922-29214944 CAGCAGAATTTCAAAACACATGG + Intergenic
1136362568 16:29790434-29790456 CTGCAGAAAGTAAAGGGAAAGGG + Intergenic
1136866275 16:33758058-33758080 CTGCAGAAGCTACATGCACAGGG - Intergenic
1138863614 16:60790243-60790265 CTGCAGAAGTTGCAAGCACCAGG + Intergenic
1139020056 16:62737680-62737702 CTGTAGAAAATTAAAGCAGATGG - Intergenic
1139025060 16:62805906-62805928 CTGGAGAAACTATAAGCCCAAGG + Intergenic
1140005232 16:71068121-71068143 CAGCAGGAAATAAAAACACAGGG - Intronic
1203105886 16_KI270728v1_random:1358137-1358159 CTGCAGAAGCTACATGCACAGGG + Intergenic
1203127628 16_KI270728v1_random:1604231-1604253 CTGCAGAAGCTACATGCACAGGG - Intergenic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1144508713 17:15856902-15856924 CTGCAGAAATTTACATAACAAGG + Intergenic
1144740236 17:17577711-17577733 CTACAGCAGTTAAAAGCACTAGG + Intronic
1145172832 17:20674542-20674564 CTGCAGAAATTTACATAACAAGG + Intergenic
1146102907 17:30003208-30003230 CTACTGAAATAAAAAGCTCAAGG - Intronic
1146831102 17:36070261-36070283 ATGCAGAAATTAAAATGTCAGGG + Intronic
1147333696 17:39714303-39714325 CTGCAGCTATTGAAAGAACAAGG - Intronic
1148541531 17:48484338-48484360 TTGCAGAAAACAAAAGCCCAAGG + Intergenic
1148599395 17:48882633-48882655 CTGCATTAATTAAAGGTACATGG - Intergenic
1148691863 17:49533019-49533041 TTTCAGAAGTTAAAAGCAGAGGG - Intergenic
1149536285 17:57436075-57436097 ATGAAGCAATTAAAAGCAGAAGG + Intronic
1151075511 17:71267711-71267733 ATGAATAAATAAAAAGCACATGG + Intergenic
1153104055 18:1507574-1507596 CTCCAAAAATTAACTGCACAGGG - Intergenic
1154504823 18:15025868-15025890 AAGCAGAAATTAAAAGGATAAGG + Intergenic
1155251778 18:23959567-23959589 CTGCTGAAATTACAGGCCCAAGG - Intergenic
1155836787 18:30595169-30595191 CTGCAGAAACTGTAAGCTCACGG + Intergenic
1156181559 18:34611586-34611608 CTAAAGAAATAAAAAGCACCAGG + Intronic
1157188793 18:45562961-45562983 CTATAAAAATTAATAGCACAGGG - Intronic
1158081594 18:53598960-53598982 ATGCAGAAATGCTAAGCACAAGG + Intergenic
1158465907 18:57689715-57689737 CTGCAGAAAATCAAAGCAGGGGG + Intronic
1158829371 18:61260956-61260978 CTGCATATATAAAAATCACATGG + Intergenic
1159050829 18:63419812-63419834 CTGTGGAAAGTAAAACCACAGGG + Intronic
1159053681 18:63444643-63444665 CTCAATAAATTAAAAGCACGTGG + Intergenic
1159213710 18:65363226-65363248 CAGCAGAAATGAAATGGACATGG - Intergenic
1159369204 18:67509892-67509914 CTGCAAAAGTTGAAAGCAAATGG - Exonic
1159687403 18:71439506-71439528 CTTCAGAAGCAAAAAGCACAGGG + Intergenic
1159802200 18:72915061-72915083 CTACAGTAAACAAAAGCACAGGG - Intergenic
1160349968 18:78169656-78169678 CTGCTGAAACAAAAAGCAGAAGG - Intergenic
1161594701 19:5145067-5145089 CTGCCTAAGTTAGAAGCACAGGG + Intronic
1166318363 19:42001577-42001599 CTCCAGAAACTAAAATCCCATGG + Intronic
1166476164 19:43126698-43126720 TTGCAGAAATGAAAAACACGTGG - Intronic
1168078889 19:53994833-53994855 CTGCAGAAATAAAATGATCAAGG - Intronic
1168599685 19:57707882-57707904 CTGGAGAAATTCCAAGCCCAGGG - Intronic
1202635931 1_KI270706v1_random:44326-44348 AAGCAGAAATTAAAAGCAGCTGG + Intergenic
925200422 2:1963662-1963684 CTCCATAACTTAAAAGTACAAGG - Intronic
926065739 2:9838248-9838270 CAGCAGAAGTTAAAGGCAGAAGG + Intergenic
927000046 2:18785516-18785538 CTAGAGAAATTTAAAGTACATGG - Intergenic
927546758 2:23960933-23960955 CTGTAGAAATAGAAAGCAGACGG - Intronic
928150312 2:28821826-28821848 CTTCAGAAATTAGAATAACATGG - Intronic
928962509 2:36942190-36942212 CTACAGACATTAAGACCACAGGG - Intronic
929774392 2:44919378-44919400 CTGCAGAAACAAAAGCCACAGGG - Intergenic
930465667 2:51745763-51745785 CTTCAGAAAATAAAAGATCAAGG - Intergenic
931344505 2:61433726-61433748 CTGCCCAAATTAGGAGCACAAGG + Intronic
931428390 2:62191342-62191364 GTGAAGAAATGAAAGGCACAAGG - Intergenic
932127982 2:69161844-69161866 ATGCAGAATTTAAAAGGCCAGGG + Intronic
932799248 2:74724895-74724917 CTTGAGGAATTAAAAGCCCATGG + Intergenic
933260163 2:80123490-80123512 CTGGAGACATTAATAACACATGG + Intronic
935436450 2:103040166-103040188 CTGCTGTAATCAAAAGTACATGG - Intergenic
935615369 2:105074614-105074636 ATGTAGGAATTAAAAGCACATGG + Intronic
935764367 2:106350740-106350762 CGCAAGAAATTAAACGCACAGGG - Intergenic
936417087 2:112325657-112325679 CTTCAGAAAAAAAAAGCAAAAGG - Intronic
936830411 2:116638328-116638350 CTGTAGTAACTAAAAGAACATGG + Intergenic
937460476 2:122081242-122081264 CTGCATGAATAAAAAGCAAAAGG + Intergenic
937830884 2:126421793-126421815 AAGCACAAATTAAAACCACAAGG - Intergenic
938504016 2:131856075-131856097 AAGCAGAAATTAAAAGGATAAGG + Intergenic
940524025 2:154789155-154789177 TTGCAAAAAGAAAAAGCACAAGG + Intronic
940756598 2:157689985-157690007 ATTCAGAACATAAAAGCACAAGG - Intergenic
941343333 2:164335746-164335768 AAGCAGAAATCAAAAGCCCATGG + Intergenic
941345080 2:164358479-164358501 TTTCAGAAAGTAAAAGAACAAGG + Intergenic
943175853 2:184472848-184472870 CTGTTGAAATTAAAACTACAGGG + Intergenic
943273145 2:185833320-185833342 CTACTGAAAATAAAAGCAAAAGG + Intergenic
943322390 2:186461667-186461689 CTGCTGAATTTAACTGCACATGG - Intergenic
943384826 2:187189041-187189063 CTTCAGGGATTTAAAGCACATGG + Intergenic
943512915 2:188848432-188848454 ATGCAGAGATTAAGAGCACATGG - Intergenic
943712110 2:191108611-191108633 ATACAGAGCTTAAAAGCACATGG + Intronic
943733693 2:191330562-191330584 TTGCATTTATTAAAAGCACAAGG - Intronic
945826351 2:214724605-214724627 CTGCAGAATACAAAAGCACAAGG - Intergenic
946534179 2:220608237-220608259 CTGCAGAAATTTAAGTAACAAGG - Intergenic
946789067 2:223281804-223281826 TTGCAGATATTATAACCACACGG + Intergenic
947027739 2:225757695-225757717 CTGTAAATATTAAAAGCACATGG + Intergenic
947786354 2:232824621-232824643 TTCCATAAAATAAAAGCACAAGG + Intronic
947881160 2:233514377-233514399 CAGCTGAAGTTAAAAGCAAAGGG + Intronic
948283099 2:236763439-236763461 CTGCAGATATTCGAAACACATGG - Intergenic
1170904513 20:20501382-20501404 CTTCATAAAATGAAAGCACAAGG - Intronic
1170942578 20:20861173-20861195 ATGCAGAAAATAAGAGCTCACGG + Intergenic
1171882085 20:30625382-30625404 AAGCAGAAATTAAAAGCAGCTGG + Intergenic
1172182421 20:33011511-33011533 ATGCAGAAACTAAAGGCATAGGG + Intronic
1172247393 20:33455409-33455431 TTCCAGAGATTAGAAGCACAGGG + Intergenic
1172471291 20:35198551-35198573 CTCCAGAACATAAAAGTACAAGG + Intergenic
1172924147 20:38515090-38515112 ATTCAGAAATTAGAAGAACAAGG - Intronic
1173721007 20:45258074-45258096 CTGCACACATTAAGCGCACAGGG + Intergenic
1173792180 20:45834696-45834718 CTGCAGGCATTAAATGTACAGGG + Intronic
1174202227 20:48814731-48814753 CTACGGACATTAACAGCACAAGG - Intronic
1174287095 20:49481513-49481535 ATGGAGATATTAAAATCACAGGG + Intronic
1174708343 20:52679506-52679528 CTTCAGAAAAAAAAAGCACTGGG - Intergenic
1175006101 20:55685010-55685032 CTCCATAAATTAAAATCCCATGG + Intergenic
1176675852 21:9776460-9776482 CTCCAGAGATGAAAACCACAAGG + Intergenic
1177017142 21:15806005-15806027 AAGCAGAAACAAAAAGCACAAGG - Intronic
1177018580 21:15822962-15822984 CTACAGCAAATAAAAGCAAATGG - Intronic
1177300438 21:19237437-19237459 CTGAAGAAACTAAAGGAACATGG - Intergenic
1177691662 21:24517989-24518011 CTACAGTAATTAAAAGAGCATGG + Intergenic
1177992422 21:28054105-28054127 AAGCAGAAATTAAAAGGATAAGG - Intergenic
1178165755 21:29974480-29974502 CTGAATAAATTAAAAACAAATGG + Intergenic
1179278546 21:39913883-39913905 CTGCAGGGATTAGAAGCTCAGGG + Intronic
1180364781 22:11928914-11928936 AAGCAGAAATTAAAAGCAGCTGG - Intergenic
1181898135 22:26129237-26129259 CTGTAGAAAGCAAAAGCAAAAGG - Intergenic
1183506444 22:38211756-38211778 GTGCAGAAATGGAAAGCACATGG - Intronic
1183676598 22:39302259-39302281 ATGCAGAAATTTACAGGACAAGG - Intergenic
1185420848 22:50733523-50733545 CAGCAGAATTTAAAAGCAACCGG - Intergenic
949252306 3:2001163-2001185 CTGCAGAAAGTAAAACTAAAAGG - Intergenic
949454909 3:4228054-4228076 CTGCAGGAACTAAAAGCAGAAGG + Intronic
949887022 3:8703693-8703715 CTGCAGTACTGAGAAGCACATGG - Intronic
951413937 3:22399737-22399759 CTGCAGTAATCAAAACCATATGG - Intergenic
952086683 3:29830845-29830867 CAACAGAAAATAGAAGCACAGGG + Intronic
952722651 3:36549292-36549314 CTGCAGAAATTAAAAGCACAAGG + Intergenic
953132164 3:40150499-40150521 TTGGAAAAATAAAAAGCACAAGG - Intronic
955189001 3:56743034-56743056 CTGCAGGAATAAAAACAACAGGG - Intronic
955439923 3:58944397-58944419 CTCCAGAAATTACCAGCCCATGG + Intronic
956573150 3:70719441-70719463 TTGCAGACATTAACATCACAGGG - Intergenic
956699860 3:71949292-71949314 CTGCCGAAATAAAAAGCATCTGG - Intergenic
957597074 3:82280347-82280369 CTGCTGAAAAAAAAAGAACAGGG + Intergenic
957622250 3:82608700-82608722 CTGCAGAAAGTCAAGGCAAAAGG + Intergenic
958533820 3:95369404-95369426 CTACAGATATTAAAAGTAAATGG + Intergenic
958591475 3:96163792-96163814 CTACAAAAATTAAAAACACATGG + Intergenic
958777095 3:98498593-98498615 CTGCTGAAAATAAAATCTCAAGG + Exonic
959882813 3:111465101-111465123 CTGTAAAAATTAAAAGAGCAAGG - Intronic
960246514 3:115405724-115405746 CTGCAGAGATGAAAACCAGAAGG + Intergenic
960549570 3:118959713-118959735 CAGCAGTAATTAAACACACATGG - Intronic
961931814 3:130541707-130541729 TTTCAGAAGATAAAAGCACAGGG - Intergenic
963045324 3:141098155-141098177 TTGCAGTAATTAAAACCACTTGG - Intronic
963567812 3:146951651-146951673 CTGGAGTAACTAAAAGCCCATGG + Intergenic
964400863 3:156296872-156296894 CTGGAGAAATTAAGGGCATATGG - Intronic
964510846 3:157449363-157449385 ATGCATAAATTAATAGCAGATGG - Intronic
966130490 3:176632935-176632957 CTGAAGAAAATAAAATCCCAGGG + Intergenic
968059955 3:195720453-195720475 CTTAAGAAAATAAAAGCACTTGG + Intergenic
968300075 3:197605974-197605996 TTGCAAAAAATAAAAACACATGG + Intergenic
969167307 4:5327993-5328015 CTCCAGAACATAAAAGCACAAGG - Intronic
969434983 4:7183912-7183934 AAGCAGAAATAAAAACCACAGGG + Intergenic
969923108 4:10559427-10559449 CTGGAGAAATTGAAAGCTGATGG - Intronic
969953998 4:10869262-10869284 CTGCAGTAATTAAAACAGCATGG - Intergenic
970732990 4:19130297-19130319 CTATAGAAATAAAAACCACATGG + Intergenic
971048192 4:22829693-22829715 GTGCACAAATTAAAATAACAGGG + Intergenic
971577715 4:28297755-28297777 CTACAGTAATTAAAACAACATGG - Intergenic
971601672 4:28599323-28599345 TTTCAGAAATTAAAATCATAAGG - Intergenic
971956865 4:33431587-33431609 ACACAGAAGTTAAAAGCACAGGG + Intergenic
973072215 4:45876764-45876786 GGGAAGAAAATAAAAGCACATGG + Intergenic
973365753 4:49207842-49207864 AAGCAGAAATTAAAAGCAGCTGG + Intergenic
973394844 4:49584611-49584633 AAGCAGAAATTAAAAGCAGCTGG - Intergenic
973838559 4:54836997-54837019 CTGGAGAAATTGACAGCATAAGG + Intergenic
974240707 4:59242657-59242679 CTACAGAAATTAAAACAATATGG - Intergenic
974339674 4:60599254-60599276 CTGCAGTAACCAAAACCACATGG - Intergenic
975143069 4:70937884-70937906 TTGCAGAAATTAAAAATACAAGG - Intronic
975396477 4:73879896-73879918 CTGCAGAAACCAAAACAACATGG - Intergenic
975905877 4:79211390-79211412 CTGCAGAAAGAAAGAGCATATGG + Intergenic
975990992 4:80260009-80260031 CTACTGAAATGAAAAGCAAATGG + Intergenic
976653937 4:87467008-87467030 GTGCAGACTTGAAAAGCACAAGG - Intergenic
976893582 4:90080691-90080713 CTGCAGAAATTATAGGAAGAAGG - Intergenic
977070676 4:92381828-92381850 TTGCCAAAATTAAAACCACAGGG - Intronic
977287839 4:95131224-95131246 CTGCAGATATCAAAGGGACAGGG + Exonic
977308396 4:95354232-95354254 CTACAGGAATTTAAACCACAGGG - Intronic
977830550 4:101586357-101586379 CTGGAGAAATAGAAAGCAGAGGG - Intronic
978292605 4:107162277-107162299 TTTCAGGAATTAAAAGCAGAGGG + Intronic
978438084 4:108707279-108707301 GTGCAGAAATTAGAAAAACATGG - Intergenic
978684722 4:111426486-111426508 CTGCAGAAATTCAAAGGATCAGG + Intergenic
979300215 4:119078385-119078407 CTGCAGTAACTAAAACAACATGG + Intergenic
979625419 4:122839684-122839706 CTGCAGAAATGAAATGGACAGGG - Intronic
979836998 4:125382874-125382896 CTCCATAACATAAAAGCACAAGG - Intronic
980541572 4:134202075-134202097 CTGCAGAACTTTATAGAACAAGG - Intergenic
980859713 4:138484473-138484495 CTACAGTAATTAAAGGCAAAAGG - Intergenic
980987856 4:139713292-139713314 CCCCAGGAATTAAAAGCAGATGG - Intronic
981456153 4:144955186-144955208 CCCCAGGAATTAAAAGCAGATGG + Intergenic
981726154 4:147849659-147849681 CCGGAGAAGGTAAAAGCACAGGG - Intronic
981822487 4:148901944-148901966 CTTCATAGAATAAAAGCACAGGG - Intergenic
982842997 4:160216303-160216325 CTACAGTAATTAAAACAACATGG - Intergenic
983141025 4:164149395-164149417 CTTCAGAAATTATCAGAACATGG + Intronic
983381181 4:166996289-166996311 CTGCTGATATTAAAAGGAAAAGG - Intronic
985399689 4:189582242-189582264 CTCCAGAGATGAAAACCACAAGG - Intergenic
1202763252 4_GL000008v2_random:130189-130211 AAGCAGAAATTAAAAGCAGCTGG + Intergenic
985832904 5:2249148-2249170 CTGCAGCAATTAGAGTCACATGG - Intergenic
985832930 5:2249411-2249433 CTGCAGCAATTAGAGTCACAGGG - Intergenic
986236194 5:5913095-5913117 CTGCAGAAAGCAAAACCACAGGG + Intergenic
986353373 5:6901200-6901222 CTGAAGAAATAAAAAACAGATGG - Intergenic
986639621 5:9859322-9859344 CTGCAGAAAGAAAAAGCTGAAGG + Intergenic
988025555 5:25683528-25683550 CTGCAGAAATAAGAAGGAAAGGG - Intergenic
989961278 5:50418611-50418633 GTGGATAAATGAAAAGCACATGG - Intronic
990253423 5:53940610-53940632 CTGGAGAAATAAAAGTCACATGG + Intronic
991007720 5:61846242-61846264 CTCAAGAAAGTTAAAGCACATGG + Intergenic
991982164 5:72243624-72243646 CTGCACAAAATAAAAGCACCAGG + Intronic
992821212 5:80498323-80498345 CTGCAGAATTTAAAAAAAAAAGG - Intronic
993906411 5:93628652-93628674 CTCCAGAACATAAAAGCGCAAGG - Intronic
993943601 5:94092359-94092381 ATGAAGAAATTTCAAGCACAAGG - Intronic
994772790 5:104004463-104004485 CTACAGGAATTATAAGCTCATGG + Intergenic
995906819 5:117134682-117134704 CCTCAGAATTTAAAAACACAAGG - Intergenic
996895296 5:128473967-128473989 CTGCAGTCTTTCAAAGCACAAGG + Intronic
998807880 5:145936673-145936695 CAGCAGAAGTTACATGCACAAGG + Intronic
998915717 5:147009085-147009107 CAGCAGGTAATAAAAGCACATGG - Intronic
1000579817 5:163022218-163022240 ATGCAGAAATGAAAAAGACAAGG - Intergenic
1002418698 5:179134568-179134590 CTCCATAAATTAAAATCCCAAGG + Intronic
1003448043 6:6202968-6202990 GTGTACAAATTCAAAGCACATGG - Intronic
1003906553 6:10705520-10705542 CTGCAGGAAAAAAAATCACATGG - Intronic
1004005261 6:11632272-11632294 CTGCTGAAATGAAAAGAAAAGGG - Intergenic
1004005604 6:11634658-11634680 CTGCTGAAATGAAAAGAAAAGGG - Intergenic
1004757609 6:18629889-18629911 CTGAAGAAATGAAAAGTGCAGGG + Intergenic
1005193040 6:23249097-23249119 CTGCAGATATTAAAAGATTAAGG - Intergenic
1006183156 6:32166082-32166104 CTGGAGAAATTAATAGGAGAGGG + Intronic
1006200381 6:32283419-32283441 CTACAGTAACTAAAAGAACATGG + Intergenic
1006852638 6:37110080-37110102 CTGCAGAAATGAAGAGATCATGG + Intergenic
1007162903 6:39806789-39806811 ATACATAAATTAAAATCACAAGG + Intronic
1007920423 6:45604556-45604578 CTGCAGAAAGTAAAAGGATTAGG + Intronic
1009244713 6:61222477-61222499 CTGCAGTAACTAAAACAACACGG + Intergenic
1009827067 6:68880250-68880272 CTGCAGGAATTACTAGCAGATGG - Intronic
1010062342 6:71637595-71637617 CTGCACAAATTAAAAATAGAAGG + Intergenic
1010392913 6:75357318-75357340 CTGGAGAAAAAAACAGCACATGG + Intronic
1010734162 6:79424275-79424297 CTGCTGTAATTATAAGAACACGG - Intergenic
1011050545 6:83143780-83143802 CTGCAGAATTTAAAAACAAGAGG + Intronic
1011470787 6:87705435-87705457 CTTCAGAAACTAAAAAGACAAGG + Intergenic
1012000757 6:93651822-93651844 CTGCATAAATACAAAGCACTAGG + Intergenic
1012032540 6:94090552-94090574 CTACTGAATTTAAAAGTACATGG - Intergenic
1013004086 6:106054666-106054688 CTGAAGAAGTAAAATGCACATGG - Intergenic
1013168925 6:107618907-107618929 CTGCAGAAGCTGAAACCACAAGG + Intronic
1013697536 6:112721612-112721634 CTCCAGAGATAGAAAGCACATGG - Intergenic
1013840712 6:114389790-114389812 AAGCAGAAACTAAAAGAACAAGG + Intergenic
1014200646 6:118605580-118605602 CCCCAGGAATTAAAAGCACATGG - Intronic
1014294085 6:119596863-119596885 CTCCATAACTTAAAAGCACAAGG - Intergenic
1014963542 6:127717198-127717220 CTTCAAAAAAAAAAAGCACATGG + Intronic
1015253521 6:131152442-131152464 GTTCAGTAATGAAAAGCACACGG + Intronic
1015746479 6:136515114-136515136 CTCCATAACATAAAAGCACAAGG - Intronic
1016579478 6:145614143-145614165 CTCCATAAAATAAAAGTACAAGG - Intronic
1017638434 6:156466348-156466370 CAGGAGAAGTTAAAAGCAGAGGG - Intergenic
1018263599 6:161995849-161995871 CTCCAAAAACTAAAAGCACAAGG + Intronic
1018375994 6:163213126-163213148 ATGGACAAATTAAAAGCACGTGG + Intronic
1018997811 6:168723794-168723816 CTTCAGAACTTTAAATCACATGG - Intergenic
1020686874 7:11307222-11307244 CTTGAGAAATTAAAAGGAGAAGG + Intergenic
1020908549 7:14097852-14097874 CAGCAGAAATGAAATGCATAAGG - Intergenic
1021662499 7:22934362-22934384 CTGGAGAAACAAAAAGAACAGGG - Intergenic
1022866285 7:34424842-34424864 TTGAATAAATTAAAAGCATAGGG - Intergenic
1023025458 7:36045861-36045883 TTGCAGAAGTGAAAAGGACAAGG + Intergenic
1023105211 7:36757049-36757071 CTGCAGAAAATATACACACATGG - Intergenic
1023155165 7:37243311-37243333 GTGCAGAAGTTAAAATCAGATGG - Intronic
1023526778 7:41112339-41112361 CTGCAAAATTTAAAAATACATGG + Intergenic
1023603292 7:41902378-41902400 CTGCGGCAATTCAGAGCACAAGG + Intergenic
1023710219 7:42984711-42984733 CTCCATAACATAAAAGCACAAGG - Intergenic
1023759005 7:43445975-43445997 CTGCTGACTTTCAAAGCACATGG + Intronic
1023934166 7:44727357-44727379 CTCCATAAATTAAAATTACATGG + Intergenic
1024151307 7:46574341-46574363 CTGCAGTAACTAAAACAACATGG + Intergenic
1024706017 7:51960495-51960517 CTGCAGACATTAAAAGGATAAGG - Intergenic
1027209269 7:76131593-76131615 CTGAATATATTAAAAGAACAAGG + Intergenic
1027887380 7:83926584-83926606 CATAAGACATTAAAAGCACAAGG - Intergenic
1028005381 7:85559805-85559827 CAGCAGAAATTAAACTCAAATGG - Intergenic
1030719831 7:112857389-112857411 CTGTAAAGATTAAAAGAACATGG - Intronic
1030744049 7:113143821-113143843 CTGCACAAATTAAATAAACAAGG + Intergenic
1030957739 7:115876360-115876382 ATGCAGAGATTAAAAGAAGAAGG - Intergenic
1031149889 7:118041416-118041438 GTGCAGAAAGTCAGAGCACATGG - Intergenic
1031406312 7:121391624-121391646 CTGCAGAATTTAAGTGCACCAGG + Intronic
1031955131 7:127935239-127935261 GTGCAGAAAGTAAAAGCCAAAGG + Intronic
1032912190 7:136445851-136445873 CAGCATAAATAAAAAGAACATGG - Intergenic
1033080518 7:138292670-138292692 CTTCACAAAATAAAAGCGCAAGG - Intergenic
1033704887 7:143876800-143876822 CTGCAGAATTTAAGAGGAGAGGG - Intronic
1034881894 7:154769015-154769037 CTGGAGAAAGTAAATTCACATGG - Intronic
1035652319 8:1277382-1277404 ATGCAGAAATTAAGAGAGCACGG + Intergenic
1036674267 8:10817030-10817052 CTGTAGAAATTAAAATCAGTAGG + Intronic
1036824581 8:11966217-11966239 TTGCAGAAATACACAGCACAGGG - Intergenic
1036836612 8:12075074-12075096 CTGCAGAAACTAAAACAACATGG - Intergenic
1036858455 8:12321641-12321663 CTGCAGAAACTAAAACAACATGG - Intergenic
1036962460 8:13259985-13260007 CAGGAGAAATGAAAAGCAGAAGG + Intronic
1037410905 8:18596078-18596100 AAGTAGAAATTAAAAGCAGAAGG + Intronic
1037519768 8:19669372-19669394 CTACAAACATTCAAAGCACATGG + Intronic
1038880265 8:31603739-31603761 CTGCAGCAATTAAAAGAAAAAGG - Intergenic
1039322829 8:36451737-36451759 GTGCAGGAGTTCAAAGCACATGG - Intergenic
1041734280 8:61093520-61093542 CTGCAGAAATTTACAGCAAATGG + Intronic
1042041023 8:64588740-64588762 CTGCAGAAATAGACTGCACATGG - Intronic
1044016168 8:87050841-87050863 ATGGATAACTTAAAAGCACAAGG - Intronic
1044809467 8:96043378-96043400 CTGCAGAACTTCACAGCAAAAGG + Intergenic
1044980345 8:97710183-97710205 TTACAGAAATTACAAGCAGATGG - Intronic
1045362050 8:101441925-101441947 TTGTAGAAGTTAAAAGCACAGGG - Intergenic
1045585031 8:103524898-103524920 CTGCAGGAATTAGAAACAGAAGG + Intronic
1046301421 8:112296916-112296938 CTTAAGAAATTAAAAGAATAAGG + Intronic
1046428099 8:114082903-114082925 CTGTTGAAATTTAAAGCAGAAGG + Intergenic
1047019561 8:120760506-120760528 CTTCAGAAATTAAAAACTCCTGG + Intronic
1047617624 8:126575967-126575989 ATGAAGAAATTAAAACCTCAAGG + Intergenic
1047693775 8:127383266-127383288 CTGCAGAAATTAAAATTTCCAGG + Intergenic
1047788281 8:128176060-128176082 CAGCAGAAAATAATGGCACAGGG - Intergenic
1048206646 8:132420766-132420788 CTCCAGAAATGCAAAACACATGG - Intronic
1050125770 9:2354986-2355008 CTGCAGACTTTAAACACACAGGG + Intergenic
1050634442 9:7596518-7596540 ATGCAAAAATCAAAACCACAAGG + Intergenic
1051804287 9:20974420-20974442 CAGCAGAAAAGAGAAGCACAGGG - Intronic
1051951700 9:22642650-22642672 GTGGATAAATTAAAAACACAGGG + Intergenic
1052949736 9:34198813-34198835 CTGCAGAAACTATAGGCCCAGGG + Intronic
1053341105 9:37333426-37333448 GGGCAGGAATAAAAAGCACAGGG - Intronic
1053571891 9:39318515-39318537 CTGCAGAAATTTGCAGAACAAGG + Intergenic
1053601923 9:39619621-39619643 CTGCAGATATTGAAAACAGAAGG + Intergenic
1053859577 9:42373388-42373410 CTGCAGATATTGAAAACAGAAGG + Intergenic
1054093445 9:60877226-60877248 CTGCAGAAATTTGCAGAACAAGG + Intergenic
1054114928 9:61153146-61153168 CTGCAGAAATTTGCAGAACAAGG + Intergenic
1054125254 9:61300496-61300518 CTGCAGAAATTTGCAGAACAAGG - Intergenic
1054251613 9:62722806-62722828 CTGCAGATATTGAAAACAGAAGG - Intergenic
1054565724 9:66757323-66757345 CTGCAGATATTGAAAACAGAAGG - Intergenic
1054592828 9:67029388-67029410 CTGCAGAAATTTGCAGAACAAGG - Intergenic
1055407843 9:75993705-75993727 CAGCAGAAAGAAAACGCACATGG + Intronic
1055592693 9:77833939-77833961 CTGATAAAATTAAAACCACATGG + Intronic
1056269145 9:84929715-84929737 CTACAAAAATTAAACGGACATGG - Intronic
1057087080 9:92221059-92221081 CTGCAGAAAGTAAAAGACAAAGG + Intronic
1057325949 9:94063552-94063574 ATACAGGAATTAAAATCACAGGG - Intronic
1057734963 9:97648555-97648577 CTTCAGGAAATGAAAGCACAGGG - Intronic
1057756382 9:97840784-97840806 CTGGAGAAATTAGAATCACTGGG + Intergenic
1057883455 9:98809963-98809985 CTGCAGGAATTAGAAGCAGGAGG - Intronic
1058333743 9:103799180-103799202 CTGCAGATATGAAATCCACAAGG + Intergenic
1058562289 9:106242883-106242905 CTCCAGGAATTAAAAACAGAGGG + Intergenic
1058616126 9:106829995-106830017 CTGCAGAAGTTAAAGGCACCAGG - Intergenic
1060023449 9:120151370-120151392 CTTCAGAATACAAAAGCACATGG - Intergenic
1061572952 9:131488938-131488960 CTGCAGACATCAAAACCACTAGG - Intronic
1061770481 9:132916378-132916400 ATCAAGAAATTAAAAGCACAGGG - Intronic
1203544016 Un_KI270743v1:115060-115082 AAGCAGAAATTAAAAGCAGCTGG + Intergenic
1185431793 X:15502-15524 GTGCTGGGATTAAAAGCACAAGG - Intergenic
1185441112 X:228218-228240 GTGCTGGGATTAAAAGCACAAGG - Intergenic
1186185796 X:7018563-7018585 TTGCAGAAATGAAAAACACATGG - Intergenic
1186255266 X:7711362-7711384 CTGGAGAAAGTGAAACCACATGG + Intergenic
1187589379 X:20699740-20699762 ATGCAGAAATTGAAGGCAGATGG + Intergenic
1187674578 X:21702922-21702944 CTGCAGACATTTGAAGCCCAAGG + Intergenic
1188179820 X:27040691-27040713 TTCCAGAAAATAAAAGCAGAAGG - Intergenic
1188771044 X:34154921-34154943 CTACAGTAACTAAAAGAACATGG - Intergenic
1189541588 X:41996962-41996984 AAGAAGAAATTAAAAGCACTGGG - Intergenic
1189770555 X:44421891-44421913 TAGCAGAAATTAAAAACTCAGGG + Intergenic
1190482183 X:50888683-50888705 CTCCATAACATAAAAGCACAAGG - Intergenic
1190617852 X:52255649-52255671 TTTTAGAAAATAAAAGCACAGGG - Intergenic
1191594888 X:62932924-62932946 CCCCAGGAATTAAAAGCAGATGG - Intergenic
1191614650 X:63156123-63156145 CTGCAGTAAACAAAACCACATGG + Intergenic
1191621646 X:63222804-63222826 CTGCAGTAAACAAAACCACATGG - Intergenic
1192150534 X:68709461-68709483 CTACAGAAAGTAAAAGCCCCTGG - Intronic
1196187972 X:112764686-112764708 ATTCAGAAATTAACAGAACAAGG - Intergenic
1197390285 X:125854981-125855003 CTGCAGTAATTAAAACAGCATGG - Intergenic
1197689604 X:129484105-129484127 TTGCTAAAATTAGAAGCACAAGG + Intronic
1197710109 X:129659919-129659941 ATGTTGAAATTAAAAGCCCAAGG + Intergenic
1197821941 X:130550360-130550382 TTCCAGAAATGAGAAGCACAAGG + Intergenic
1197964718 X:132047163-132047185 CTTCAGAAATATAAATCACAGGG + Intergenic
1198041246 X:132854661-132854683 CTGCAGTTTTTAAAAGCAGAAGG - Intronic
1198104358 X:133448289-133448311 CTGCTGGTATTAAAAGCACCAGG + Intergenic
1199279594 X:145985094-145985116 CTAGAGAAATTAAAAACACATGG + Intergenic
1199372194 X:147063398-147063420 CAGCAGAAGTTAAAAGAATAGGG + Intergenic
1200735572 Y:6790400-6790422 CTTCAGAAATGAAAAGAAAAGGG - Intergenic
1201467494 Y:14299547-14299569 CTGAAGAAAATAAAAGAAGATGG + Intergenic
1202181901 Y:22146950-22146972 CTGCAGAAAAATAAAGAACATGG + Intergenic
1202209459 Y:22439452-22439474 CTGCAGAAAAATAAAGAACATGG - Intergenic