ID: 952725639

View in Genome Browser
Species Human (GRCh38)
Location 3:36581816-36581838
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952725628_952725639 24 Left 952725628 3:36581769-36581791 CCCTCCAGCAGCAGCCGTGTGAT No data
Right 952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG No data
952725632_952725639 10 Left 952725632 3:36581783-36581805 CCGTGTGATGTGGAGAATCTATG No data
Right 952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG No data
952725627_952725639 28 Left 952725627 3:36581765-36581787 CCATCCCTCCAGCAGCAGCCGTG No data
Right 952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG No data
952725630_952725639 20 Left 952725630 3:36581773-36581795 CCAGCAGCAGCCGTGTGATGTGG No data
Right 952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG No data
952725629_952725639 23 Left 952725629 3:36581770-36581792 CCTCCAGCAGCAGCCGTGTGATG No data
Right 952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type