ID: 952726505

View in Genome Browser
Species Human (GRCh38)
Location 3:36591998-36592020
Sequence ATGTGATGATGTTAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952726505_952726512 9 Left 952726505 3:36591998-36592020 CCCACTTCCTAACATCATCACAT No data
Right 952726512 3:36592030-36592052 GGCTTCAACATACGAATTTGAGG 0: 8
1: 195
2: 864
3: 2172
4: 3656
952726505_952726513 12 Left 952726505 3:36591998-36592020 CCCACTTCCTAACATCATCACAT No data
Right 952726513 3:36592033-36592055 TTCAACATACGAATTTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952726505 Original CRISPR ATGTGATGATGTTAGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr