ID: 952730239

View in Genome Browser
Species Human (GRCh38)
Location 3:36630900-36630922
Sequence GCTGAAGTCCAGAGAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952730239_952730240 -4 Left 952730239 3:36630900-36630922 CCATCTTCTCTCTGGACTTCAGC No data
Right 952730240 3:36630919-36630941 CAGCAGCTGTCTTCCCCTTCTGG No data
952730239_952730244 16 Left 952730239 3:36630900-36630922 CCATCTTCTCTCTGGACTTCAGC No data
Right 952730244 3:36630939-36630961 TGGCCGCAGATCTGATTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952730239 Original CRISPR GCTGAAGTCCAGAGAGAAGA TGG (reversed) Intergenic
No off target data available for this crispr