ID: 952733619

View in Genome Browser
Species Human (GRCh38)
Location 3:36665954-36665976
Sequence TCTTACATATAGAGAGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952733619_952733622 22 Left 952733619 3:36665954-36665976 CCATGCACTCTCTATATGTAAGA No data
Right 952733622 3:36665999-36666021 AATGTTCTGCCCATATCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952733619 Original CRISPR TCTTACATATAGAGAGTGCA TGG (reversed) Intergenic
No off target data available for this crispr