ID: 952733622

View in Genome Browser
Species Human (GRCh38)
Location 3:36665999-36666021
Sequence AATGTTCTGCCCATATCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952733619_952733622 22 Left 952733619 3:36665954-36665976 CCATGCACTCTCTATATGTAAGA No data
Right 952733622 3:36665999-36666021 AATGTTCTGCCCATATCCCCTGG No data
952733617_952733622 26 Left 952733617 3:36665950-36665972 CCCACCATGCACTCTCTATATGT No data
Right 952733622 3:36665999-36666021 AATGTTCTGCCCATATCCCCTGG No data
952733618_952733622 25 Left 952733618 3:36665951-36665973 CCACCATGCACTCTCTATATGTA No data
Right 952733622 3:36665999-36666021 AATGTTCTGCCCATATCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952733622 Original CRISPR AATGTTCTGCCCATATCCCC TGG Intergenic
No off target data available for this crispr