ID: 952734533

View in Genome Browser
Species Human (GRCh38)
Location 3:36675673-36675695
Sequence CTTTTACTTACTTGAAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952734528_952734533 9 Left 952734528 3:36675641-36675663 CCTGTGTCACCCAAGCTACACAC No data
Right 952734533 3:36675673-36675695 CTTTTACTTACTTGAAAAGCTGG No data
952734529_952734533 0 Left 952734529 3:36675650-36675672 CCCAAGCTACACACTCCTTCCTG No data
Right 952734533 3:36675673-36675695 CTTTTACTTACTTGAAAAGCTGG No data
952734526_952734533 25 Left 952734526 3:36675625-36675647 CCATCAGCTGGCCTCTCCTGTGT No data
Right 952734533 3:36675673-36675695 CTTTTACTTACTTGAAAAGCTGG No data
952734527_952734533 14 Left 952734527 3:36675636-36675658 CCTCTCCTGTGTCACCCAAGCTA No data
Right 952734533 3:36675673-36675695 CTTTTACTTACTTGAAAAGCTGG No data
952734530_952734533 -1 Left 952734530 3:36675651-36675673 CCAAGCTACACACTCCTTCCTGC No data
Right 952734533 3:36675673-36675695 CTTTTACTTACTTGAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952734533 Original CRISPR CTTTTACTTACTTGAAAAGC TGG Intergenic
No off target data available for this crispr