ID: 952738917

View in Genome Browser
Species Human (GRCh38)
Location 3:36716795-36716817
Sequence GAGAAGGGTGTGACTACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 410}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952738906_952738917 28 Left 952738906 3:36716744-36716766 CCTGGGCTCTGGGGGCACATCCC 0: 1
1: 0
2: 4
3: 31
4: 371
Right 952738917 3:36716795-36716817 GAGAAGGGTGTGACTACAGCAGG 0: 1
1: 0
2: 1
3: 23
4: 410
952738909_952738917 7 Left 952738909 3:36716765-36716787 CCCTAGGCCCCATACTCTCCTCA 0: 1
1: 0
2: 0
3: 9
4: 198
Right 952738917 3:36716795-36716817 GAGAAGGGTGTGACTACAGCAGG 0: 1
1: 0
2: 1
3: 23
4: 410
952738910_952738917 6 Left 952738910 3:36716766-36716788 CCTAGGCCCCATACTCTCCTCAC 0: 1
1: 0
2: 1
3: 29
4: 264
Right 952738917 3:36716795-36716817 GAGAAGGGTGTGACTACAGCAGG 0: 1
1: 0
2: 1
3: 23
4: 410
952738908_952738917 8 Left 952738908 3:36716764-36716786 CCCCTAGGCCCCATACTCTCCTC 0: 1
1: 0
2: 1
3: 21
4: 226
Right 952738917 3:36716795-36716817 GAGAAGGGTGTGACTACAGCAGG 0: 1
1: 0
2: 1
3: 23
4: 410
952738913_952738917 -2 Left 952738913 3:36716774-36716796 CCATACTCTCCTCACTCTGTAGA 0: 1
1: 0
2: 2
3: 29
4: 216
Right 952738917 3:36716795-36716817 GAGAAGGGTGTGACTACAGCAGG 0: 1
1: 0
2: 1
3: 23
4: 410
952738912_952738917 -1 Left 952738912 3:36716773-36716795 CCCATACTCTCCTCACTCTGTAG 0: 1
1: 0
2: 1
3: 16
4: 190
Right 952738917 3:36716795-36716817 GAGAAGGGTGTGACTACAGCAGG 0: 1
1: 0
2: 1
3: 23
4: 410
952738911_952738917 0 Left 952738911 3:36716772-36716794 CCCCATACTCTCCTCACTCTGTA 0: 1
1: 0
2: 1
3: 23
4: 281
Right 952738917 3:36716795-36716817 GAGAAGGGTGTGACTACAGCAGG 0: 1
1: 0
2: 1
3: 23
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952738917 Original CRISPR GAGAAGGGTGTGACTACAGC AGG Intronic
900470228 1:2849983-2850005 GATAAGGGGGTGACTGCACCAGG - Intergenic
900741957 1:4335869-4335891 GAGAATGGTGTGACAGGAGCTGG - Intergenic
900878684 1:5364940-5364962 GAGAAGGCTGTGAGTAGAGAAGG - Intergenic
901065260 1:6491212-6491234 GGGAAGGGTGTGGATACAGGGGG + Intronic
901255050 1:7817155-7817177 GAGAAGGAGGTGACTACAGAGGG + Intronic
901376298 1:8842114-8842136 GAGAATGGTGTGAACACAGGAGG - Intergenic
901918157 1:12516158-12516180 GAGAATGGTGTGAACACAGGAGG - Intergenic
902151545 1:14447326-14447348 GAGAATGGTGTGAATCCAGGAGG - Intergenic
904960947 1:34332390-34332412 GAGTTGGGTGTAACTCCAGCTGG - Intergenic
906609910 1:47194121-47194143 TAGAAGGGAGTGACTTCAGATGG - Intergenic
907128279 1:52072142-52072164 GAGAATGGTGTGAACACAGGAGG - Intronic
908524573 1:64975703-64975725 GAGAAGGGTATGACTGCAAAGGG - Intergenic
908704653 1:66938452-66938474 GAGAAGATTGTGCCTACAGTTGG + Intronic
910478642 1:87635052-87635074 GAGAATGGTGTGAATCCAGGAGG + Intergenic
910577248 1:88778801-88778823 GAGAATGGTGTGAATCCAGGAGG - Intronic
912865396 1:113251634-113251656 GAGAATGGTGTGAACCCAGCAGG + Intergenic
914438185 1:147679304-147679326 GAGAATGGTGTGAACCCAGCAGG + Intergenic
915141707 1:153772174-153772196 GAGAAAGGTGTGCCTAGAACAGG - Intronic
915274013 1:154775702-154775724 GAGGAGGGTGAGTCTCCAGCTGG - Intronic
915866163 1:159501298-159501320 TAGAAGGGAGTGACATCAGCAGG - Intergenic
916677558 1:167076496-167076518 GAGAAGTGTGTTAATCCAGCTGG - Intronic
917467465 1:175293907-175293929 GAGAATGGTGTGAACACAGGAGG + Intergenic
919105607 1:193147080-193147102 GAGAATGGCGTGAATCCAGCAGG - Intronic
920075749 1:203335196-203335218 GAGAATGGTGTGACCCCAGGAGG + Intergenic
920424298 1:205861318-205861340 GAAAAGGCTGTGACTGCAGCAGG + Intergenic
920444668 1:206006881-206006903 GGGAAGGGTGTGATTAGAGCTGG + Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
922447869 1:225712804-225712826 GAGAATGGTGTGAATCCAGGAGG - Intergenic
922458569 1:225797039-225797061 GAAAAGGCTGTGACTGCAGCGGG - Intergenic
922735221 1:227975083-227975105 GAGAATGGTGTGAACCCAGCGGG + Intergenic
923575408 1:235154154-235154176 GAGAAGGGTGTGAACCCAGGAGG + Intronic
1063336543 10:5220893-5220915 GAGAATGGTGTGACCCCAGGAGG + Intergenic
1063695686 10:8332832-8332854 GAGATGGGGGTGGGTACAGCAGG - Intergenic
1065238334 10:23678488-23678510 GAGAATGGTGTGAACACAGGAGG + Intergenic
1066538060 10:36412762-36412784 GAGAATGGTGTGACCCCAGGAGG + Intergenic
1066568081 10:36741533-36741555 GAGAATGGTGTGAACCCAGCAGG + Intergenic
1067504492 10:46838379-46838401 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1067590095 10:47501617-47501639 GAGAATGGTGTGAATCCAGGAGG + Intergenic
1068316793 10:55354892-55354914 GAGAAAGGTGTAACTACAAAGGG - Intronic
1068890365 10:62142424-62142446 GAGAATGGTGTGAATTCAGGAGG - Intergenic
1068927889 10:62558910-62558932 TAGAATGGTGTGAGTGCAGCAGG + Intronic
1070049448 10:72873106-72873128 GAGAATGGTGTGAATCCAGGAGG - Intronic
1070630532 10:78081595-78081617 GAGAGGGGTGTGGCCACAGGAGG + Intergenic
1071316544 10:84406265-84406287 GAGGAGGGTGTAACTATAACTGG + Intronic
1071965811 10:90851513-90851535 GAGAATGGTGTGAGTCCAGGAGG + Intronic
1072655083 10:97324338-97324360 GAGAATGGTGTGACCCCAGGAGG - Intergenic
1072877073 10:99183872-99183894 AAGAAGGGTATGAATACAGAAGG + Intronic
1073211184 10:101804360-101804382 GAGAATGGTGTGAATCCAGGAGG - Intronic
1073289379 10:102405816-102405838 GAGAAGGGTGTGAGGGCTGCAGG - Intronic
1073421303 10:103425767-103425789 GAGAAGGGTGTGAACCCAGGAGG - Intronic
1073894798 10:108142895-108142917 GAGAATGGTGTGAACACAGGAGG + Intergenic
1074392810 10:113072143-113072165 GAGAATGGTGTGAATCCAGGAGG - Intronic
1074564236 10:114562437-114562459 GAGAATGGTGTGAATCCAGGAGG + Intronic
1074940254 10:118229343-118229365 GAGATGGGTGTGGCTATAGAAGG + Intergenic
1075381752 10:122024528-122024550 GAGGTGGGTGTGGCTACAGAAGG - Intronic
1077120792 11:907389-907411 GAGAATGGTGTGAATCCAGGAGG + Intronic
1079285722 11:19129996-19130018 GAGAAGGGTGTGAACCCAGGAGG + Intronic
1079340417 11:19607042-19607064 AAGAAGGGTCTGCTTACAGCTGG + Intronic
1079722936 11:23842333-23842355 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1080243737 11:30156462-30156484 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1081602447 11:44504774-44504796 GTGAAGGGTGTGTGTACAGAGGG - Intergenic
1083294598 11:61708468-61708490 GAGAATGGTGTGAACCCAGCAGG - Intronic
1083577366 11:63801839-63801861 GAGAATGGTGTGAATCCAGGAGG + Intergenic
1083667788 11:64285046-64285068 GTGAAGGGAGTGATTACTGCGGG + Intronic
1083748788 11:64749880-64749902 GAGAATGGTGTGAATCCAGGAGG - Intronic
1084925651 11:72509143-72509165 GAGAATGGTGTGAACCCAGCAGG + Intergenic
1085352324 11:75807119-75807141 GAGAATGGTGTGAACACAGGAGG - Intergenic
1086465062 11:87044738-87044760 GAGAAGGGCGTGACCCCAGGAGG - Intronic
1086644888 11:89208178-89208200 GAGAATGGTGTGAATCCAGGAGG + Intronic
1087637056 11:100713803-100713825 GAGAAGGCAATGAATACAGCAGG - Intronic
1088108836 11:106237318-106237340 GGATAGGGTGTGACTACAGTTGG + Intergenic
1088241399 11:107776800-107776822 TAGAAGGTTGTGGCTACAGTGGG - Intergenic
1088357353 11:108957838-108957860 GAGCAGGGTGTGACAAAAGTGGG + Intergenic
1089600773 11:119613431-119613453 AAGAAGGGTGTGAGTAAAGGTGG + Intergenic
1089621023 11:119722343-119722365 GAGAAGGAGGTGACCCCAGCAGG + Intronic
1092502945 12:9065572-9065594 GAGAGGGGTCTGAAGACAGCTGG + Intergenic
1093095416 12:14966358-14966380 GAGGTGGGTGTGGCTACAGAAGG - Intergenic
1093269871 12:17047172-17047194 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1094318572 12:29159446-29159468 GAGAATGGTGTGAATCCAGGAGG + Intronic
1094520029 12:31176636-31176658 GAGAATGGTGTGAACCCAGCAGG - Intergenic
1095376953 12:41541541-41541563 GAGAATGGTGTGAATCCAGGAGG - Intronic
1096119417 12:49077872-49077894 GAGAAGGGTGTGAACCCAGGAGG + Intergenic
1096714595 12:53483431-53483453 GGGAAGGGTGTGGCTTCAGCAGG + Exonic
1097256124 12:57675848-57675870 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1099697704 12:86042776-86042798 GAGAATGGTGTGAATCCAGAAGG + Intronic
1101185404 12:102271050-102271072 GAGAATGGTGTGAATCCAGGAGG + Intergenic
1101463558 12:104923270-104923292 GAGAATGGTGTGAATCCAGGAGG + Intronic
1102029549 12:109732013-109732035 GAGAAGGTTGTGTCCACAGATGG - Intronic
1102488669 12:113275660-113275682 GAGAATGGTGTGAATCCAGGAGG - Intronic
1102607577 12:114080456-114080478 TAGAAGAGTGTTACTATAGCAGG + Intergenic
1102947828 12:117005524-117005546 GAGGAGGCGGTGACTCCAGCAGG - Intronic
1102954527 12:117050976-117050998 GATAAGGGTTTGACGACAGTGGG - Intronic
1105619958 13:22057188-22057210 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1105689924 13:22827146-22827168 GAGAATGGTGTGAACCCAGCAGG + Intergenic
1105880439 13:24601085-24601107 GAGAATGGTGTGAATCCAGGAGG + Intergenic
1106389509 13:29321277-29321299 AAGAAGGCTGAGACAACAGCCGG + Intronic
1107466632 13:40656918-40656940 GAGAATGGTGTGAATCCAGGAGG - Intronic
1107644630 13:42481027-42481049 GAGAATGGCGTGAACACAGCAGG + Intergenic
1107719487 13:43232766-43232788 GAGAAGTTTTTGACTACATCTGG + Intronic
1108397921 13:50007992-50008014 GAGAATGGTGTGACCCCAGGAGG - Intronic
1108575078 13:51783631-51783653 GAGGAGGGTGTGACGACAGAGGG - Intronic
1108942476 13:55974093-55974115 GAGAATGGCGTGAATACAGGAGG + Intergenic
1109304503 13:60623961-60623983 GAGAATGGTGTGAACACAGGAGG - Intergenic
1109639137 13:65164518-65164540 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1110259790 13:73472251-73472273 GAGAAGGATGAGATTACAGAGGG + Intergenic
1112465999 13:99645406-99645428 GAGAATGGTGTGAACACAGGAGG + Intronic
1112510172 13:100001866-100001888 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1113336204 13:109378432-109378454 GAGAATGGTGTGAACCCAGCAGG + Intergenic
1114281722 14:21198503-21198525 GAGAATGGTGTGAATCCAGGAGG + Intergenic
1114535451 14:23419467-23419489 GAGAATGGTGAGCCTAGAGCAGG - Exonic
1116670212 14:47831695-47831717 GAGAATGGTGTGAACACAGGAGG - Intergenic
1117791376 14:59345458-59345480 GAGAATGGTATGAGTACAGTAGG + Intronic
1118637263 14:67759153-67759175 GAGAAGGGTGTGAACCCAGGAGG + Intronic
1118811167 14:69275110-69275132 GAGAAAGGGGTGACCATAGCAGG + Intronic
1118999152 14:70865637-70865659 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1119313459 14:73670824-73670846 GAGAATGGTGTGAATTCAGGAGG - Intronic
1120855566 14:89209179-89209201 GATAAGGTGGTAACTACAGCTGG - Intronic
1120999035 14:90438144-90438166 TACAAGTGTGTGATTACAGCTGG + Intergenic
1121136741 14:91506033-91506055 GAGAATGGTGTGAACACAGGAGG - Intronic
1121209480 14:92197303-92197325 GAGAGGGGAGTGACTGCAGAGGG + Intergenic
1121484544 14:94304551-94304573 GAGGAGGGTGTGGACACAGCTGG - Exonic
1122643154 14:103173653-103173675 GAAAAGGCTGTAACTGCAGCGGG + Intergenic
1123814170 15:23959865-23959887 GAGAATGGTGTGAATCCAGGCGG + Intergenic
1125209757 15:37199732-37199754 CAGAATGCTGTGATTACAGCAGG + Intergenic
1126100195 15:45114090-45114112 GAGAAAGGTGAGAGTGCAGCCGG - Exonic
1128317713 15:66671462-66671484 GAGAGGGTTGTGACTAAACCAGG + Intronic
1130903583 15:88224913-88224935 GAGCAGGGTGTCACTAGTGCAGG + Intronic
1133491596 16:6275219-6275241 GAGAAGGGTGTGAACCCAGGAGG + Intronic
1134074920 16:11283972-11283994 GATATGGGTGGGACTCCAGCAGG - Intronic
1134101780 16:11457501-11457523 GAGAATGGTGTGAATTCAGGAGG + Intronic
1134184107 16:12069778-12069800 GAGAATGGCGTGAACACAGCAGG - Intronic
1135550965 16:23398061-23398083 GAGAGGGGTGAGACTAAAGGCGG + Exonic
1135560547 16:23472941-23472963 GAGAATGGTGTGAATCCAGGAGG + Intronic
1135664506 16:24324711-24324733 GAGAAGGCTGAGACCACAGGAGG - Intronic
1136479257 16:30531661-30531683 CAGATGGCTGTGACTACAGGTGG - Intronic
1136650330 16:31663771-31663793 GAAAAGGCTGTAACTGCAGCAGG + Intergenic
1136845805 16:33574672-33574694 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1137396453 16:48118799-48118821 GAGAATGGTTTGAATCCAGCTGG + Intronic
1137986150 16:53109772-53109794 GAGAATGGTGTGAATACGGGAGG - Intronic
1138223434 16:55272403-55272425 GAGCAGGCTGTGATTACAGCTGG + Intergenic
1138579108 16:57928154-57928176 GAGAAGGCTGTGTGTACAGCTGG - Intronic
1139774021 16:69302484-69302506 GAGGAGGGTGTCACTTCAGATGG + Exonic
1140447948 16:75046663-75046685 GAGAATGGTGTGAATCCAGGAGG - Intronic
1141597532 16:85106524-85106546 GGGAAAGATGTGACTACAGAGGG + Intronic
1141988596 16:87596201-87596223 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1142006204 16:87690644-87690666 GAGTAGGGTGGGGGTACAGCCGG + Intronic
1142054564 16:87985013-87985035 GAGAATGGTGGGACGGCAGCGGG + Intronic
1142407562 16:89899292-89899314 GGGAAGAGTGTGAGTACAGCAGG + Intronic
1203107513 16_KI270728v1_random:1423325-1423347 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1142821494 17:2471696-2471718 GAGAATGGTGTGAACCCAGCAGG + Intronic
1143175759 17:4953978-4954000 GGGAGGGGTGGGACCACAGCAGG - Intronic
1144140988 17:12347865-12347887 GAGAAGGGTGTGAACCCAGGAGG + Intergenic
1144463236 17:15475193-15475215 GAGAATGGTGTGAATCCAGGAGG + Intronic
1144690862 17:17262638-17262660 GAGAAGGGTGTGAACCCAGGAGG + Intronic
1144810795 17:17997669-17997691 GAGCAGGGAGGGCCTACAGCAGG - Intronic
1145993759 17:29094126-29094148 GGGAAGGGGGTGGCCACAGCTGG - Intronic
1147348615 17:39822670-39822692 GAGAATGGTGTGAATCCAGGAGG - Intronic
1147369747 17:39984108-39984130 GAGAATGGTGTGAACCCAGCAGG + Intronic
1148264345 17:46213388-46213410 GAGAATGGTGTGAACCCAGCAGG - Intronic
1148372355 17:47110176-47110198 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1149740960 17:59045237-59045259 GAGAATGGTGTGAATCCAGAAGG + Intronic
1150417135 17:64996767-64996789 GAGATGGGTGTGACACCAGTGGG + Intergenic
1150507407 17:65713674-65713696 GAGAATGGTGTGAACCCAGCAGG - Intronic
1150704150 17:67472555-67472577 GAGAATGGTGTGAATCCAGGAGG + Intronic
1150758137 17:67934577-67934599 TAGAAGTATGTGAGTACAGCTGG + Intronic
1150794529 17:68227155-68227177 GAGATGGGTGTGACACCAGTGGG - Intergenic
1151735444 17:75937258-75937280 GAGAATGGTGTGAACACAGGAGG - Intronic
1151746124 17:76012832-76012854 GAGAATGGTGTGAATCCAGGAGG - Intronic
1151994831 17:77601993-77602015 GAGAATGGTCTGACAACAGTCGG - Intergenic
1152167492 17:78719769-78719791 CAAAGGGGTGTGACTAGAGCAGG + Intronic
1152266231 17:79296637-79296659 GAGATGGGAGAGTCTACAGCTGG - Intronic
1152467246 17:80473282-80473304 GAGAAGGGCGTGCCCACACCTGG + Exonic
1153663570 18:7347975-7347997 GAGAATGGTGTGAATCCAGGAGG + Intergenic
1153892317 18:9529194-9529216 GAGAATGGTGTGAACCCAGCGGG - Intronic
1155987943 18:32250745-32250767 GAGAATGGTGTGAATCCAGGAGG - Intronic
1157173585 18:45430663-45430685 GAGAATGGTGTGAACACAGGAGG - Intronic
1158500745 18:57998705-57998727 GAGAAGGCTGTGAGTACATGGGG + Intergenic
1158962819 18:62600810-62600832 GGGATGGGTGTGTCTGCAGCTGG - Intergenic
1159456619 18:68667626-68667648 GAGAATGGTGTGAACACAGGAGG + Intergenic
1159972085 18:74667143-74667165 GAGAAGGGTGTGACGAGAGCTGG - Intronic
1160406889 18:78652505-78652527 GAGAAGGCTCTGAGCACAGCAGG + Intergenic
1161075972 19:2285952-2285974 GAGATGGGTGTTACTTTAGCTGG + Intronic
1161357433 19:3826764-3826786 GAGAACAGTGATACTACAGCAGG + Intronic
1161390848 19:4019473-4019495 GAGAAGGGTGGGTCCCCAGCAGG - Intronic
1162387718 19:10369952-10369974 GAGAATGGTGTGAATTCAGGAGG + Intronic
1162693647 19:12454228-12454250 GAAAAGGCTGTAACTGCAGCAGG + Intronic
1163401453 19:17095850-17095872 GAGAATGGTGTGAATCCAGGAGG - Intronic
1163837594 19:19584502-19584524 CTGAAGGGTGTCCCTACAGCTGG + Intronic
1163923648 19:20318286-20318308 GAAAAGTCTGTGACTGCAGCAGG - Intergenic
1164144689 19:22504777-22504799 GGGAGGGGTGAGACTAGAGCAGG + Intronic
1164185167 19:22860130-22860152 GAGAATGGTGTGAATCCAGGAGG + Intergenic
1165605674 19:37101798-37101820 CAGATGGGTGTGCCTTCAGCAGG + Intronic
1166010052 19:39935173-39935195 AAGAAGGGAGTGAGGACAGCTGG + Intergenic
1166313671 19:41976720-41976742 GAGAAGGGGGCTACTGCAGCAGG + Intronic
1166410964 19:42555192-42555214 GAGCAGGGTCTGGCCACAGCAGG - Intronic
1166462235 19:42998394-42998416 GAGAATGGTGTGAATCCAGGAGG - Intronic
1166479507 19:43158357-43158379 GAGAATGGTGTGAATCCAGGAGG - Intronic
1167445310 19:49533970-49533992 GAGAAGGGCGTGACTCGACCTGG + Intronic
1168537461 19:57183054-57183076 GAGAATGGTGTGAACCCAGCAGG - Intergenic
925767549 2:7251206-7251228 GAGAACGGTGTGAACCCAGCAGG + Intergenic
926158804 2:10473972-10473994 GAGAATGGTGTGAATCCAGGAGG - Intergenic
927375188 2:22405257-22405279 GAGAAGGGATTGACAACATCTGG + Intergenic
929456730 2:42071451-42071473 GAGAATGGTGTGAATCCAGGAGG + Intergenic
930505391 2:52277085-52277107 GATGAGGGTGTTACTTCAGCTGG + Intergenic
932953040 2:76316194-76316216 GAGAATGGTGTGAATCCAGGTGG + Intergenic
932962081 2:76424774-76424796 TAGAAGGATGTGAATACAGAAGG - Intergenic
933551705 2:83785971-83785993 GAGAATGGTGTGAATCCAGGAGG - Intergenic
933807991 2:86013987-86014009 GAGAGGGGTGTAACTAGAGATGG + Intergenic
933906581 2:86899965-86899987 GAGAATGGTGTGAACCCAGCAGG - Intergenic
934024893 2:87993671-87993693 GAGAATGGTGTGAACCCAGCAGG + Intergenic
934059727 2:88283032-88283054 GGGAAGGGTGGGACTAGATCTGG - Intergenic
934086241 2:88512439-88512461 GAGAACGGTGTGAATCCAGGAGG - Intergenic
934585702 2:95492577-95492599 GAGAATGGTGTGAATCCAGGAGG - Intergenic
934729202 2:96646086-96646108 GAGAAGGGTGTGAACCCAGGAGG - Intergenic
935157156 2:100493666-100493688 GAGAATGGTGTGAATCCAGGAGG - Intergenic
935958599 2:108402028-108402050 GAGAAGATAGGGACTACAGCTGG - Intergenic
936490589 2:112968481-112968503 GAGAAGGGCGTGAACCCAGCAGG + Intergenic
936925645 2:117734107-117734129 GAGAAGGATTTGACTAGATCAGG + Intergenic
937229319 2:120388357-120388379 GAGAAGGGTGTTTCTGGAGCAGG + Intergenic
937482230 2:122273792-122273814 GAGAAGGTGGTGGCTACAGGGGG + Intergenic
939251960 2:139693131-139693153 GAGAAGGGTGTGAACCCAGGAGG - Intergenic
940660456 2:156538729-156538751 GAGAATGGTGTGAATCCAGGAGG + Intronic
940879155 2:158929195-158929217 GGGAAGGGTGTGTCTGCAGCAGG - Intergenic
942366366 2:175232517-175232539 GAGAATGGTGTGAATCCAGGAGG - Intergenic
943194404 2:184725778-184725800 GAGGAGGGTGTGACTATAAAGGG - Intronic
945239222 2:207660918-207660940 GAGAAGGGTGTGACGAAAGGGGG + Intergenic
945301891 2:208222154-208222176 GAGACTGGTGTTACTACAGGAGG - Intergenic
947319380 2:228898960-228898982 GAGAAGGGTGTGCCAACAGGAGG - Intronic
1170018638 20:11811449-11811471 GAGAAAGGTGTGACCCCAGGAGG - Intergenic
1170753207 20:19171157-19171179 GACAAGGATGTAAGTACAGCTGG - Intergenic
1171435135 20:25116375-25116397 GAGAAGGGAGTGAGCAAAGCTGG - Intergenic
1172130827 20:32653579-32653601 AAGAAGAGTGTTCCTACAGCTGG + Intergenic
1172301403 20:33852995-33853017 GAGAGGGAGGTGACCACAGCTGG - Intronic
1173441083 20:43076857-43076879 GAGAAGGGTATGACTTGAGGAGG - Intronic
1174753440 20:53135287-53135309 GAGGAGGGTGTGACTGGAGAGGG - Intronic
1175549639 20:59808798-59808820 GAGAAGCGAGGGTCTACAGCAGG + Intronic
1176203088 20:63872791-63872813 GAGAATGGTGTGAATCCAGGAGG - Intronic
1176229842 20:64026708-64026730 GAGAATGGTGTGAACCCAGCAGG + Intronic
1177969828 21:27776267-27776289 GAGAATGGTGTGAACCCAGCAGG + Intergenic
1177973371 21:27817707-27817729 GAGAATGGTGTGAATCCAGGAGG + Intergenic
1178787185 21:35664500-35664522 GCAAAGGGTATGACTACAGATGG - Intronic
1179077567 21:38137305-38137327 GAGAATGGTGTGAATCCAGGAGG + Intronic
1181578543 22:23812952-23812974 GAGAATGGTGTGAATCCAGGAGG - Intronic
1181736950 22:24889737-24889759 GAGAATGGTGTGAACTCAGCAGG - Intronic
1181740107 22:24914201-24914223 GAGAATGGTGTGAACCCAGCAGG + Intronic
1183508985 22:38224202-38224224 GAGAATGGTGTGAATCCAGGAGG - Intronic
1183783320 22:40012991-40013013 GAGAATGGTGTGAACCCAGCAGG + Intronic
1184237797 22:43194129-43194151 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1184594855 22:45507615-45507637 GAGAATGGTTTGAATACAGGAGG - Intronic
1184999054 22:48231280-48231302 GAGAATGGTGTGAACCCAGCAGG + Intergenic
1185257540 22:49843969-49843991 GAGGCGGGTGTGACTATAGATGG + Intergenic
1185327861 22:50236223-50236245 GAGAATGGTGTGAACCCAGCAGG - Intronic
950241554 3:11374812-11374834 GAGAAGGGTGTGAACCCAGGAGG + Intronic
950742175 3:15060789-15060811 GAGAATGGTGTGAATCCAGGAGG + Intronic
951249593 3:20379799-20379821 GAGAATGGTGTGAATCCAGGAGG - Intergenic
952738917 3:36716795-36716817 GAGAAGGGTGTGACTACAGCAGG + Intronic
953443084 3:42936494-42936516 GAGGCGGGTGTGGCTACTGCTGG + Intronic
954207067 3:49067476-49067498 GAGAATGGTGTGATTCCAGGAGG + Intronic
954209400 3:49086344-49086366 GAGAATGGTGTGAATCCAGGAGG - Intronic
954234249 3:49243666-49243688 GAGAATGGTGTGAATCCAGGAGG + Intronic
956092666 3:65684524-65684546 GAGATGGGTGTGGCTATAGAAGG + Intronic
956613167 3:71144823-71144845 GAGGAGGGTGTGATTACAACAGG - Intronic
957299930 3:78378846-78378868 GAGAAAGGTGTGTATACAGAAGG - Intergenic
958753803 3:98226011-98226033 GAAATGGGTGTGACTATAGAGGG - Intergenic
959241847 3:103807069-103807091 GAGAATGGTGTGAAGACAGGAGG + Intergenic
959946740 3:112133253-112133275 GAGAAGGGTGTCTCTGCAGAGGG + Exonic
961432871 3:126895689-126895711 CAGGAGGGTGTGACTCCTGCTGG + Intronic
961478190 3:127161666-127161688 GCAAAGGGTGTGACAACATCTGG - Intergenic
963049654 3:141129983-141130005 AAAAGGGTTGTGACTACAGCTGG - Intronic
965802574 3:172509887-172509909 GAGAATGGTGTGAATCCAGGAGG + Intronic
967877455 3:194276926-194276948 GTGAACGGTGTGACCACACCAGG + Intergenic
968383722 4:117664-117686 AAGAAGAGGGTGACTTCAGCAGG + Intergenic
969255136 4:5996266-5996288 GAGAAGGCTTTGCCTGCAGCAGG - Intergenic
969305855 4:6325948-6325970 GAGAAGTGTTTGACTCCAGGAGG + Intronic
969353570 4:6612363-6612385 GAGGAGTGTGAGACCACAGCTGG + Intronic
969404672 4:6982437-6982459 GGGTAGGGTGTGACTACCGAGGG + Intronic
971300124 4:25435045-25435067 GAGAATCTTGTGACTATAGCTGG - Intergenic
972142619 4:35979146-35979168 GAGAATGGTGTGAATCCAGGAGG + Intronic
972210980 4:36836868-36836890 GAGAATGGTGTGAACCCAGCAGG + Intergenic
972477391 4:39463765-39463787 GAGAAGGGTGAGATTACAACAGG - Intronic
972952119 4:44340386-44340408 GAGAATGGTGTGAACACAGGAGG - Intronic
973595995 4:52490575-52490597 GAGAATGGTGTGAATCCAGGAGG + Intergenic
974559530 4:63498887-63498909 GAGAATGGTGTGAATCCAGGAGG + Intergenic
974732551 4:65887401-65887423 GAGAATGGTGTGAATCCAGGAGG + Intergenic
977034357 4:91931199-91931221 GAGAATGGTGTGAATCCAGGAGG - Intergenic
979803122 4:124936688-124936710 AAGGAGGGTGTGATTACAGTAGG - Intergenic
982020201 4:151195280-151195302 GAGAATGGTGTGAACCCAGCAGG + Intronic
982219464 4:153112346-153112368 GAGCAGGGTGTGGGGACAGCTGG - Intergenic
982237481 4:153265431-153265453 GAGAATGGTGTGAATCCAGGAGG - Intronic
982253013 4:153425998-153426020 GAGAATGGTGTGAATCCAGGAGG + Intergenic
982523790 4:156452604-156452626 GAGAATGGTGTGAATCCAGGAGG + Intergenic
982936383 4:161482224-161482246 GAGAATGGTGTGAATCCAGGAGG + Intronic
982994461 4:162323435-162323457 GAGAAGAATGTGATTGCAGCTGG + Intergenic
983434679 4:167697951-167697973 GAGAAGTGTATGATTACAGAAGG + Intergenic
984104043 4:175521865-175521887 GAGATGGATGTGACTCCTGCTGG - Intergenic
984684976 4:182657314-182657336 GAGAGGGGTTTGAGTATAGCAGG - Intronic
986030491 5:3888782-3888804 GAGATGTGTGTGAAAACAGCTGG - Intergenic
986353439 5:6902206-6902228 GAGAAGAGTGGGGCTACAGGTGG + Intergenic
988493873 5:31727911-31727933 GAGAATGGTGTGAATCCAGGAGG + Intronic
989371600 5:40716344-40716366 GAAAAGTGTGTTACTTCAGCTGG + Exonic
989626180 5:43431411-43431433 GAGGAGGGTGTGACTATGGAAGG + Intergenic
990998648 5:61759290-61759312 GACAGGGGTGTGACTACAACAGG - Intergenic
991379835 5:66008327-66008349 GAGAATGGTGTGAATACGGGAGG + Intronic
991867543 5:71078624-71078646 GAGAATGGTGTGAATCCAGGAGG - Intergenic
991994325 5:72372138-72372160 GGGGAGAGTGTGACTACAGAAGG + Intergenic
992399005 5:76394482-76394504 GAGAATGGTGTGAATCCAGAAGG + Intergenic
992463267 5:76982929-76982951 GAGAATGGTGTGAATCCAGGAGG - Intergenic
993295506 5:86133762-86133784 AATAAGGGTGTGACTACAGGAGG + Intergenic
994783188 5:104118764-104118786 GAGAAGGGTGTGAACCCAGGAGG + Intergenic
995382111 5:111547086-111547108 GAGAATGGTGTGAATCCAGAAGG + Intergenic
996029164 5:118685569-118685591 GAGAAGGGTGGGGGTATAGCAGG - Intergenic
997677215 5:135721762-135721784 GAGAACTGTGTGTCCACAGCAGG + Intergenic
998027418 5:138830270-138830292 GAGAATGGTGTGAATCCAGCAGG + Intronic
998171028 5:139872109-139872131 GAGCAGGGTGAGAAGACAGCAGG + Intronic
998501573 5:142637407-142637429 GAGAATGGTGTGAATCCAGGAGG - Intronic
1000161063 5:158598270-158598292 GAGAAGGGTGTGAACCCAGGAGG - Intergenic
1000928857 5:167228792-167228814 GAGAATGGTGTGAACACAGGAGG - Intergenic
1001582238 5:172806736-172806758 GAGAATGGTGTGAACCCAGCAGG - Intergenic
1002123024 5:177020518-177020540 GAGAATGGTGTGAACCCAGCAGG - Intronic
1002341811 5:178521461-178521483 GAGAATGGTGTGAACCCAGCAGG + Intronic
1002883915 6:1276833-1276855 AAGGAGGGCGTGACCACAGCAGG + Intergenic
1002976411 6:2082375-2082397 GAGAAGAGTGTCACTGCTGCTGG + Intronic
1003477268 6:6494997-6495019 GCCAGAGGTGTGACTACAGCCGG - Intergenic
1003977225 6:11355808-11355830 GAGAATGGTGTGAACACAGGAGG - Intronic
1005007336 6:21301114-21301136 GAGAATGGTGTGAACACAGGAGG + Intergenic
1005105860 6:22223526-22223548 GACAAGGGTCTGATTCCAGCAGG - Intergenic
1005141137 6:22632845-22632867 GAGAAGGGTTTGACTCCCACGGG - Intergenic
1005199065 6:23322534-23322556 GAGAATGGTGTGAATCCAGGAGG + Intergenic
1005304982 6:24504944-24504966 GAGAAGGGCGTGTCTTCGGCAGG - Exonic
1005352063 6:24946629-24946651 GAGCAGAGTAGGACTACAGCAGG + Intronic
1005977667 6:30812597-30812619 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1006764994 6:36497282-36497304 GAGAAGGTCTGGACTACAGCAGG + Intronic
1007317686 6:41002694-41002716 GAGAAGGGTCTGAGAACTGCAGG - Intergenic
1009347830 6:62638268-62638290 GAGAATGGTGTGAATCCAGGAGG + Intergenic
1012024281 6:93968281-93968303 AAGAAGGGTGTGAATTAAGCAGG - Intergenic
1012951918 6:105527223-105527245 AAGAAGAGTGTGACAACAGAAGG - Intergenic
1013593399 6:111639985-111640007 GAGAATGGTGTGAACCCAGCAGG + Intergenic
1013905113 6:115206930-115206952 GAGAAGGGTGTGAACCCAGGAGG + Intergenic
1015040105 6:128706161-128706183 GAGAATGGTGTGAACCCAGCAGG + Intergenic
1015259711 6:131222435-131222457 GAGAATGGTGTGAATCCAGGAGG + Intronic
1015354765 6:132264782-132264804 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1015886848 6:137926358-137926380 CAGAGGGCTGTAACTACAGCTGG - Intergenic
1016887091 6:148968690-148968712 GAAAAGGGAGTGGCTTCAGCAGG - Intronic
1017353598 6:153475191-153475213 GTCAAGGGTATGACCACAGCAGG + Intergenic
1017961251 6:159223083-159223105 GAGAATGGTGTGAATCCAGGAGG - Intronic
1018199076 6:161378805-161378827 GTGCAGGGTGTGTCTCCAGCAGG + Intronic
1018298592 6:162376590-162376612 GAGAGGGGAGTTACTACACCAGG + Intronic
1019401896 7:859550-859572 GAGAAGGGTGTGTCCACACGTGG + Intronic
1019504718 7:1385222-1385244 GACACAGGTGTGGCTACAGCAGG + Intergenic
1020167881 7:5822579-5822601 GAGAATGGTGTGAACCCAGCAGG - Intergenic
1020226498 7:6284564-6284586 GAGAGTGGTGTGACTGCAGCAGG + Intergenic
1020236261 7:6358078-6358100 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1020349471 7:7202078-7202100 GAGAAGGATGTGACCTCACCTGG - Intronic
1021750741 7:23796662-23796684 GAGGAGGCTGTGACTACAAAGGG - Intronic
1021866921 7:24967433-24967455 GGGAAGGGTGTTAATAGAGCAGG - Intronic
1022034458 7:26520467-26520489 GAAAAGGGTGTCATCACAGCTGG + Intergenic
1022622378 7:31998107-31998129 GAGAATGGTGTGAACACAGGAGG - Intronic
1023457899 7:40361482-40361504 GAGAATGGTGTGAATGCAGGAGG + Intronic
1024079981 7:45848109-45848131 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1025956403 7:66186480-66186502 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1026934068 7:74241973-74241995 GAGAAGGATGTGAAACCAGCAGG + Intronic
1027047226 7:74999083-74999105 GAGAATGGTGTGAGCACAGGAGG - Intronic
1030041843 7:105458660-105458682 GAGAATGGTGTGAACACAGAAGG - Intronic
1030743300 7:113135241-113135263 GAGAATGGTGTGAATCCAGGAGG + Intergenic
1031738604 7:125398778-125398800 GAGAAGGGTGTGAACCCAGGAGG + Intergenic
1031923204 7:127615948-127615970 CAGAAGGATGAGACTCCAGCTGG + Intergenic
1034195806 7:149246470-149246492 GAGAATGGTGTGAACCCAGCAGG - Intronic
1034312887 7:150105170-150105192 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1034926574 7:155127667-155127689 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1035856675 8:2983274-2983296 GAGAATGGCGTGAATCCAGCAGG - Intronic
1036210713 8:6838344-6838366 GAGAAAGGTGTGAACCCAGCAGG + Intergenic
1036549429 8:9803709-9803731 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1036671037 8:10788128-10788150 AAGAGGGGTGGGAGTACAGCTGG + Intronic
1037709386 8:21343568-21343590 GATAAGGGTGGGACTATAGCTGG - Intergenic
1037916668 8:22777299-22777321 GAGGAGGGTGTGGCTACCCCAGG + Intronic
1038759324 8:30372095-30372117 GAGAATGGTGTGAACACAGGAGG - Intergenic
1038866680 8:31445956-31445978 GAGAATGGTGTGAGTATAGAAGG + Intergenic
1040396925 8:47009276-47009298 GAGAATGGTGTGAATCCAGGAGG + Intergenic
1040534103 8:48290967-48290989 GAGGAGGGTGTGGCTACAAAAGG - Intergenic
1041671470 8:60495836-60495858 GAAAAGGCTGTAACTGCAGCAGG + Intergenic
1042482424 8:69319281-69319303 GAGACAGGTGTGACTACAGAAGG - Intergenic
1043132371 8:76477260-76477282 GAGCAGGGTGTGTCTACTGAGGG + Intergenic
1044806893 8:96017464-96017486 GAGAATGGTGTGAATCCAGGGGG + Intergenic
1045656816 8:104395452-104395474 GGGGAGGGCGTGACTACAGAGGG - Intronic
1046249416 8:111610402-111610424 GAGAATGGTGTGAATCCAGGAGG + Intergenic
1046929187 8:119825772-119825794 GAGAATGGTGTGAACACAGGAGG - Intronic
1049110130 8:140637048-140637070 GAGAGGGCTGTGACCACAGCAGG + Intergenic
1050230196 9:3516136-3516158 GAGAATGGTGTGAATACAGGAGG - Intronic
1050575962 9:6995759-6995781 GAGAATGGTGTGAACCCAGCAGG - Intronic
1050720838 9:8587058-8587080 GAGAATGGTGTGAGTCCAGGAGG + Intronic
1051497981 9:17746163-17746185 GAGAATGGTGTGAACACAGCGGG - Intronic
1052008723 9:23381642-23381664 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1052350372 9:27452395-27452417 GAGAAGTGAGTGATTACAGAAGG + Intronic
1054098882 9:60924181-60924203 GAGAAGGATGTGTCAACAGGTGG - Intergenic
1054120280 9:61199802-61199824 GAGAAGGATGTGTCAACAGGTGG - Intergenic
1055080415 9:72263080-72263102 GAGAATGGTGTGAATCCAGGAGG + Intergenic
1055301169 9:74884397-74884419 GAGAATGGTGTGAACCCAGCAGG + Intronic
1055366739 9:75552450-75552472 GAAATGGGTTTGACTAAAGCAGG + Intergenic
1055812378 9:80163850-80163872 GAGTAGGGTGGGCCTACTGCTGG + Intergenic
1055929597 9:81545969-81545991 GAAAAGGGTGTGACAATATCAGG + Intergenic
1056140820 9:83678109-83678131 GAGAATGGTGTGAACACAGGAGG - Intronic
1056428745 9:86505596-86505618 GAGAATGGTGTGAATCCAGGAGG + Intergenic
1056492843 9:87124989-87125011 AGGAAGGGTGTGACGACAGGAGG - Intergenic
1056631335 9:88295496-88295518 GATCAGGCTGTGACTATAGCAGG - Intergenic
1057136130 9:92689107-92689129 GAGAATGGTGTGAATCCAGGAGG + Intergenic
1057494290 9:95547820-95547842 GAGAATGGTGTGAACCCAGCAGG + Intergenic
1058378032 9:104347325-104347347 GAGAATGGTGTGAATCCAGGAGG + Intergenic
1060450317 9:123732522-123732544 GAGAAGGGTTTGACCACACAGGG + Intronic
1061608077 9:131726671-131726693 GAGAAGGGTATGACTGCAAAGGG + Intronic
1187994658 X:24913321-24913343 GAGAATGGTGTGAATACAAAGGG + Intronic
1188892442 X:35627414-35627436 GAGAATGGTGTGACCCCAGAAGG - Intergenic
1188931244 X:36113897-36113919 GAGAATGGTGTGACCCCAGGAGG - Intronic
1189359509 X:40338896-40338918 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1190724776 X:53181876-53181898 GAGAATGGTGTGAACCCAGCAGG - Intergenic
1192176869 X:68891909-68891931 GATAGGGGTGTGAGTAGAGCTGG + Intergenic
1193747495 X:85299592-85299614 GAGAATGGTGTGAAAACAGGAGG - Intronic
1193906081 X:87245876-87245898 GAGAAGAGGGTGTCAACAGCGGG - Intergenic
1194230058 X:91310822-91310844 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1194805219 X:98318610-98318632 GAGAATGGTGTGAATCCAGGAGG + Intergenic
1195263691 X:103159670-103159692 GAGAATGGTGTGAACACAGGGGG + Intergenic
1196712322 X:118775732-118775754 GAGAAGGCTGTGAGGAGAGCTGG + Intronic
1196895926 X:120335653-120335675 GAGAAGGGTGTGAACCCAGGAGG - Intergenic
1196989457 X:121312082-121312104 GAGAAGAGTGTGGCTAAAGGAGG - Intergenic
1197338985 X:125243199-125243221 GAGAATGGTGTGAACCCAGCAGG + Intergenic
1197858696 X:130947032-130947054 GAGATGGGTGTGATTTTAGCAGG - Intergenic
1198473847 X:136976567-136976589 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1198868985 X:141155941-141155963 TAGAAGGGTGTGCCCTCAGCTGG - Intergenic
1199351741 X:146810013-146810035 GAGAAGGGTGTGAGTTGAGGAGG - Intergenic
1199352166 X:146814480-146814502 GAGAAGGGTGTGAGTTGAGGAGG + Intergenic
1199600625 X:149539550-149539572 GAGCAGGGTGGGGCTGCAGCAGG - Intergenic
1199870138 X:151891018-151891040 GAGAATGGTGTGAATCCAGGAGG + Intergenic
1200398431 X:156004666-156004688 GAGAAGGGAGGAACTAGAGCGGG + Intronic
1200415587 Y:2906709-2906731 GAGAATGGTGTGAACCCAGCAGG - Intronic
1201286292 Y:12381534-12381556 GAGAATGGTGTGAATCCAGGAGG - Intergenic
1201402345 Y:13616947-13616969 GAAAAGGCTGTAACTGCAGCAGG - Intergenic