ID: 952744984

View in Genome Browser
Species Human (GRCh38)
Location 3:36768653-36768675
Sequence TCCCTTTGGCCCCATTGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952744980_952744984 6 Left 952744980 3:36768624-36768646 CCCCAGCTCTGCTCAATAATCAC No data
Right 952744984 3:36768653-36768675 TCCCTTTGGCCCCATTGTAATGG No data
952744981_952744984 5 Left 952744981 3:36768625-36768647 CCCAGCTCTGCTCAATAATCACT No data
Right 952744984 3:36768653-36768675 TCCCTTTGGCCCCATTGTAATGG No data
952744979_952744984 30 Left 952744979 3:36768600-36768622 CCATCTTTTGTTACTTTGGGACT No data
Right 952744984 3:36768653-36768675 TCCCTTTGGCCCCATTGTAATGG No data
952744982_952744984 4 Left 952744982 3:36768626-36768648 CCAGCTCTGCTCAATAATCACTG No data
Right 952744984 3:36768653-36768675 TCCCTTTGGCCCCATTGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952744984 Original CRISPR TCCCTTTGGCCCCATTGTAA TGG Intergenic
No off target data available for this crispr