ID: 952746703

View in Genome Browser
Species Human (GRCh38)
Location 3:36788273-36788295
Sequence TAGCTGAGACTACTAGTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952746699_952746703 -8 Left 952746699 3:36788258-36788280 CCTCAGCCTCCAGAGTAGCTGAG 0: 519
1: 19867
2: 223808
3: 274403
4: 172553
Right 952746703 3:36788273-36788295 TAGCTGAGACTACTAGTGATGGG No data
952746698_952746703 -5 Left 952746698 3:36788255-36788277 CCACCTCAGCCTCCAGAGTAGCT 0: 1350
1: 21540
2: 43951
3: 43163
4: 33330
Right 952746703 3:36788273-36788295 TAGCTGAGACTACTAGTGATGGG No data
952746695_952746703 15 Left 952746695 3:36788235-36788257 CCTGGGCTCAGGTGATCCTCCCA 0: 1640
1: 12067
2: 32810
3: 87682
4: 158958
Right 952746703 3:36788273-36788295 TAGCTGAGACTACTAGTGATGGG No data
952746697_952746703 -4 Left 952746697 3:36788254-36788276 CCCACCTCAGCCTCCAGAGTAGC 0: 1347
1: 28461
2: 222227
3: 256567
4: 152073
Right 952746703 3:36788273-36788295 TAGCTGAGACTACTAGTGATGGG No data
952746696_952746703 -1 Left 952746696 3:36788251-36788273 CCTCCCACCTCAGCCTCCAGAGT 0: 917
1: 12823
2: 32153
3: 48063
4: 79834
Right 952746703 3:36788273-36788295 TAGCTGAGACTACTAGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952746703 Original CRISPR TAGCTGAGACTACTAGTGAT GGG Intergenic
No off target data available for this crispr