ID: 952752452

View in Genome Browser
Species Human (GRCh38)
Location 3:36836218-36836240
Sequence TAGGCCAGCAAGCCTGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952752447_952752452 27 Left 952752447 3:36836168-36836190 CCCAGAAAGCGAAGGGACTGTAC 0: 1
1: 0
2: 0
3: 5
4: 91
Right 952752452 3:36836218-36836240 TAGGCCAGCAAGCCTGCTCCTGG 0: 1
1: 0
2: 0
3: 16
4: 184
952752448_952752452 26 Left 952752448 3:36836169-36836191 CCAGAAAGCGAAGGGACTGTACT 0: 1
1: 0
2: 0
3: 4
4: 60
Right 952752452 3:36836218-36836240 TAGGCCAGCAAGCCTGCTCCTGG 0: 1
1: 0
2: 0
3: 16
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952752452 Original CRISPR TAGGCCAGCAAGCCTGCTCC TGG Intronic
900383178 1:2395472-2395494 ATGGCCAGCAAGGCTGCTCCTGG + Intronic
902462410 1:16588112-16588134 CAGGACACCAAGCCTGTTCCTGG - Intronic
902513227 1:16977183-16977205 TGAGCCAGCAAGCCTGCTGTGGG + Exonic
903128354 1:21262645-21262667 TAGCACAGCCAGGCTGCTCCTGG - Intronic
904120340 1:28193994-28194016 GAGGCCAGGAAGCCAGCTCCTGG + Intergenic
904210351 1:28883174-28883196 TGGGTCAGCAACCCTTCTCCAGG - Intergenic
904671087 1:32166170-32166192 TAGTCCAGCAAGCTTCCTTCCGG - Exonic
910175896 1:84429916-84429938 TAGGCCACAAGGCCTGGTCCTGG + Intergenic
910855756 1:91693624-91693646 TGGGCCAGGAAGCCAGGTCCAGG - Intronic
913603061 1:120440405-120440427 CAGGACACCAAGCCTGTTCCTGG + Intergenic
913603809 1:120446757-120446779 CAGGACACCAAGCCTGTTCCTGG + Intergenic
913640674 1:120809474-120809496 CAGGACACCAAGCCTGTTCCTGG + Intronic
914211851 1:145587150-145587172 CAGGACACCAAGCCTGTTCCTGG - Intergenic
914277804 1:146140871-146140893 CAGGACACCAAGCCTGTTCCTGG - Intronic
914364241 1:146964020-146964042 CAGGACACCAAGCCTGTTCCTGG + Intronic
914365010 1:146970310-146970332 CAGGACACCAAGCCTGTTCCTGG + Intronic
914365761 1:146976592-146976614 CAGGACACCAAGCCTGTTCCTGG + Intronic
914487441 1:148123116-148123138 CAGGACACCAAGCCTGTTCCTGG - Intronic
914538849 1:148591819-148591841 CAGGACACCAAGCCTGTTCCTGG - Intronic
914587785 1:149078270-149078292 CAGGACACCAAGCCTGTTCCTGG - Intronic
914876259 1:151514427-151514449 TAGGGCAGCAAGTCTGGACCAGG + Intronic
914892012 1:151633429-151633451 CAGGACTGCAGGCCTGCTCCAGG + Intronic
921830849 1:219725594-219725616 CAGCTCAGCAAGCCTACTCCTGG + Intronic
1064780005 10:18824987-18825009 TAAGCCAGCCAGTCTGCTTCTGG - Intergenic
1065200119 10:23304552-23304574 TGGGCAAGCAGGACTGCTCCTGG - Intronic
1067478302 10:46580059-46580081 TAGGGCAGCAACCCTGCCTCTGG - Intronic
1067616437 10:47761728-47761750 TAGGGCAGCAACCCTGCCTCTGG + Intergenic
1068977279 10:63023429-63023451 CAGGTCAGCAAGCCTGCAGCTGG - Intergenic
1072737291 10:97887774-97887796 CAGGCCAGGACTCCTGCTCCAGG - Intronic
1074171831 10:110947326-110947348 TCAGGCAGCAAGCCTGCTCGTGG + Intronic
1074402776 10:113155761-113155783 TAGGCCCGCCTGCCTGTTCCAGG + Intronic
1075414953 10:122255792-122255814 TTGGCCTGGCAGCCTGCTCCGGG + Intergenic
1076561342 10:131367120-131367142 TAGCCCAGCAATCCTATTCCTGG - Intergenic
1076637761 10:131893481-131893503 TAGGCCCGCAAGGATGATCCAGG + Intergenic
1076845561 10:133067963-133067985 TGTGCTAGAAAGCCTGCTCCCGG + Intergenic
1077318077 11:1928111-1928133 AAGGCCAGCAGGCCTGGGCCCGG - Intronic
1077482980 11:2825232-2825254 TAGCCCAGGAAGCCAGTTCCTGG + Intronic
1078600133 11:12723066-12723088 TAACCCAGAAATCCTGCTCCTGG - Intronic
1083720769 11:64602445-64602467 CAGGCCAGCTTGCCTGCCCCAGG + Intergenic
1084476579 11:69392742-69392764 TGGCCCAGCAAGCCCACTCCAGG + Intergenic
1088766884 11:112990501-112990523 GAGGTCAGCAACCCTGCTCCGGG + Intronic
1089137285 11:116259843-116259865 TAGGACATCATACCTGCTCCAGG - Intergenic
1089173303 11:116530993-116531015 CAGCCCAGCAAGCCCTCTCCTGG + Intergenic
1089364114 11:117910569-117910591 TTAGCCAGCAGGCCTGCTTCAGG - Intronic
1090945520 11:131426290-131426312 GAGGACAGAAATCCTGCTCCAGG + Intronic
1091643097 12:2252513-2252535 GAAGCCCCCAAGCCTGCTCCGGG - Intronic
1095389147 12:41685239-41685261 TAATCCAGCAATCCTGCTACTGG + Intergenic
1096533656 12:52257396-52257418 GAGGCCAGGTGGCCTGCTCCTGG + Intronic
1097054031 12:56239440-56239462 TAGCCCAGAAACCCTACTCCTGG - Exonic
1100307423 12:93363693-93363715 TAGGCCAGAAAAACTGCTTCAGG + Intergenic
1104571242 12:129927771-129927793 GAGGCCATCAAACCTTCTCCTGG + Intergenic
1104969694 12:132525642-132525664 TAGGGCTACATGCCTGCTCCCGG - Intronic
1105308220 13:19183836-19183858 TAAGCCAGCACGTCTCCTCCAGG - Intronic
1105389344 13:19959694-19959716 AAGGACACCGAGCCTGCTCCCGG - Intronic
1113385833 13:109846953-109846975 AAGGCCAGCAGGGCTGTTCCAGG + Intergenic
1117738565 14:58792043-58792065 TTGGCCAGCCAGCCTGCCCTGGG - Intergenic
1121851740 14:97227698-97227720 AAGACCAGGAAGGCTGCTCCGGG + Intergenic
1123018494 14:105386696-105386718 TAGGCCAGCAAGGGGGCCCCAGG - Intronic
1123137924 14:106047157-106047179 TAATCCAGCAATCCTGCTGCTGG - Intergenic
1124093963 15:26631112-26631134 TATTCCAGAATGCCTGCTCCCGG - Intronic
1124153952 15:27209055-27209077 GAGGCCAGCACGGCTGCTCAGGG + Intronic
1127842707 15:62844852-62844874 TTGTCCAGGACGCCTGCTCCTGG - Intergenic
1128988053 15:72235618-72235640 TGGGCCACCAAGCCTGGCCCTGG - Intergenic
1129653365 15:77506951-77506973 TAGGCCACCATGCCTGTTTCTGG + Intergenic
1131068704 15:89450488-89450510 GAGGGCTGCAAGCCTGCTCCAGG - Intergenic
1132815175 16:1822404-1822426 TAGGCCAGCAAGCCAGGCCTAGG - Intronic
1132941776 16:2512130-2512152 TAGGCCAGGAAGGCTGTGCCTGG - Intronic
1135527656 16:23226487-23226509 TGGGCCAGCCAGCATGCACCAGG + Intergenic
1135653458 16:24227124-24227146 TAGTCCAGCAAGGCTGCTTTTGG - Intergenic
1137561247 16:49503577-49503599 GCGGACAGGAAGCCTGCTCCAGG - Intronic
1138537915 16:57669518-57669540 TGGGCCTTCAAGCCTCCTCCAGG + Intronic
1143039433 17:4022654-4022676 TAGGCCAGCACATCTGCACCAGG + Intronic
1143529937 17:7496792-7496814 TAGGCCAGAACGCCGGATCCTGG - Exonic
1144659124 17:17057074-17057096 CAGGCCAGCAAGTCCTCTCCTGG - Intronic
1146929852 17:36769194-36769216 TGGGCCAGGAAGGCAGCTCCCGG - Intergenic
1148071847 17:44913233-44913255 TGGGCCAGCCTGCCTCCTCCAGG - Intronic
1148467182 17:47872340-47872362 CACGCCTGCAAGCCGGCTCCGGG - Intergenic
1149055752 17:52362913-52362935 TGACCCAGCAATCCTGCTCCTGG + Intergenic
1149348274 17:55760813-55760835 TAAGCCAGTACTCCTGCTCCAGG - Intronic
1150812662 17:68368872-68368894 CAGGCCAGCAAGCCTTATCTGGG - Intronic
1151691581 17:75689456-75689478 TAGGAAAGGAAGGCTGCTCCTGG - Intronic
1152286872 17:79417698-79417720 ATGGTCAGCAACCCTGCTCCTGG + Intronic
1152364972 17:79850234-79850256 CAGCTCAGAAAGCCTGCTCCAGG - Intergenic
1155648499 18:28111250-28111272 TAGGTCAGCAAGTGGGCTCCGGG - Intronic
1156050324 18:32924911-32924933 TATGCCAGCAATCCTACTTCTGG - Intergenic
1156454791 18:37286887-37286909 GAGGCCAGCAGGCCTTCTGCAGG - Intronic
1159825450 18:73203113-73203135 TGGCCCAGCAATCCTGCTCCTGG - Intronic
1161726867 19:5934288-5934310 CAGGCAGGCAAGCCTGTTCCTGG + Intronic
1163834962 19:19567621-19567643 TATGGCAGCAAGCCAGGTCCAGG - Intronic
1167465817 19:49650798-49650820 TGGGCCAGCAAGCAGGCACCAGG + Intronic
1168465468 19:56597818-56597840 TAACCCAGCAACCCTGTTCCTGG - Intronic
925036544 2:691825-691847 TAGAGCAGCGAGCCTGCTTCTGG - Intergenic
925100309 2:1238706-1238728 AAGGGCAGCAAGGCTGGTCCAGG - Intronic
926765702 2:16321249-16321271 AATGCAAGCAAGCCTGCTCGTGG + Intergenic
932988629 2:76759496-76759518 TAAGCCAGCAAACCTGCCCCTGG + Intronic
937363030 2:121242292-121242314 TAAACCAGCAGCCCTGCTCCTGG + Intronic
938299630 2:130200944-130200966 TAAGCCAGCACGTCTCCTCCAGG - Intergenic
938366224 2:130736670-130736692 GAGGCCAGCCTGCCAGCTCCTGG + Intergenic
938457079 2:131473542-131473564 TAAGCCAGCATGTCTCCTCCAGG + Intronic
939819376 2:146937480-146937502 TAGGTAAGCAAGCCTGCTGATGG + Intergenic
940382826 2:153035630-153035652 CAAGCCAGCAACCCTACTCCTGG + Intergenic
941042263 2:160635782-160635804 AAGGCCAGAAAGCTTGCTCCTGG - Intergenic
941159892 2:162024150-162024172 TATGCCAGCAAACCTCTTCCAGG + Intronic
944277492 2:197855525-197855547 TAGCCCAGCTAGTCTGGTCCTGG + Intronic
947628195 2:231634510-231634532 TAGGCCTGCAAGCCTGAGCTGGG + Intergenic
1169348217 20:4846557-4846579 TAGCCCAGCAATACTACTCCTGG + Intergenic
1170130290 20:13011619-13011641 TGGGGCAGCAAGCCTGCTGCAGG - Intronic
1172201805 20:33132131-33132153 GAGGCCAGCCAGCCAGCCCCAGG + Intergenic
1172806642 20:37616612-37616634 GAGGCCAGCATGGCTGCTGCTGG + Intergenic
1173218991 20:41115813-41115835 TAAGCCACCAAGCCTGGCCCAGG - Intronic
1173291326 20:41717572-41717594 TAGGACAGCAACCCTGCTGAAGG + Intergenic
1173906637 20:46634488-46634510 AAGGGCAGCAAACCTGCCCCAGG + Intronic
1174081164 20:47971754-47971776 AAGTCCAGCAAGCCTGAGCCAGG - Intergenic
1174135338 20:48375136-48375158 AAGTCCAGCAAGCCTGAGCCAGG + Intergenic
1174196931 20:48779479-48779501 TGGCCCAACAACCCTGCTCCTGG + Intronic
1174338709 20:49882910-49882932 TAGGGCAGCCAGGCTGCTGCAGG - Intronic
1174982130 20:55408180-55408202 TAGATCAGCAAGCAGGCTCCTGG - Intergenic
1179119603 21:38530500-38530522 GAGGCCAGAAAGCCTTCTCCAGG + Intronic
1180747847 22:18103748-18103770 TGGGCCAAGAAGCCTCCTCCGGG - Exonic
1181271417 22:21660992-21661014 TAGGCAAGCAAGGCAGCCCCAGG - Intronic
1182522925 22:30894504-30894526 GAGGCCAGGGAGCCTGCTCCAGG - Intronic
1183468116 22:37990290-37990312 CAGGCCAGCAAGGCAGCTCCCGG + Intronic
1184390498 22:44200777-44200799 TAGGCCAAGAGGCCTGATCCAGG - Intronic
1185242026 22:49751833-49751855 TGGGCCAGAAAAGCTGCTCCAGG + Intergenic
1185265933 22:49904019-49904041 TATGCCAGCATGCCTGTCCCCGG + Exonic
949633333 3:5953868-5953890 TAATCCAGCAATCCTGCTACTGG - Intergenic
950750029 3:15121143-15121165 CAGGCCAGCAGGCCCTCTCCAGG + Intergenic
951625809 3:24662483-24662505 CAGCCCAGCAAGCCTACCCCTGG - Intergenic
952752452 3:36836218-36836240 TAGGCCAGCAAGCCTGCTCCTGG + Intronic
954634766 3:52065457-52065479 CAAGCCAGCAACCCTGCACCTGG - Intergenic
954847412 3:53571874-53571896 TTGTCAAGCAAGCCTGGTCCTGG - Intronic
956161303 3:66356262-66356284 TAGGCCAGAAAGCCAACACCAGG - Intronic
957018871 3:75101361-75101383 TAGAGCACCAAGCATGCTCCTGG - Intergenic
957266581 3:77973942-77973964 TATGCCAGCGAGCATACTCCAGG - Intergenic
957602061 3:82349953-82349975 TTGTCCAGCAATCCTACTCCTGG - Intergenic
960581947 3:119288694-119288716 CAGCCCAGCAAGCCCACTCCTGG - Intergenic
961791492 3:129379767-129379789 TAGGCCAGCCAGTGTGCTTCGGG - Intergenic
963007296 3:140738075-140738097 TAGGCAAGCAAGTCTGGACCTGG + Intergenic
967035982 3:185648590-185648612 TTTGCCAGCAAGCCTGCACTAGG + Intronic
967183607 3:186927652-186927674 TGGGCAAGCAAGGGTGCTCCTGG - Intergenic
969703973 4:8782231-8782253 GAGGCCAGCAACCGTGCCCCTGG + Intergenic
975846173 4:78527634-78527656 TAGTCCACCAAACCTGCTCTTGG - Intronic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
984766734 4:183405610-183405632 TGGGGCAGCAAGCCTTCGCCAGG + Intergenic
985749346 5:1665494-1665516 GAGGCCAGACAGCCTGCTCCTGG - Intergenic
985780108 5:1866044-1866066 CAGGCCGGCAAGCCTCCCCCTGG - Intergenic
987439435 5:17938371-17938393 TACTCCAGCAATCCTGCTACTGG + Intergenic
988984720 5:36606444-36606466 AAAGCCAGCAAGCCTGCTTCTGG + Exonic
991249062 5:64539505-64539527 TAGGCCAGCACCACTGCACCTGG - Intronic
999661431 5:153867293-153867315 TAAGCCACCATGCCAGCTCCTGG + Intergenic
1000249596 5:159481471-159481493 TAGGTCAACAAACCTGCACCAGG + Intergenic
1001701201 5:173707685-173707707 CAGGCCAGCCACCCTGCCCCAGG - Intergenic
1001961182 5:175880970-175880992 TTGGCCAGGAAGCGTCCTCCTGG - Exonic
1002597500 5:180333990-180334012 TCGGCCAGCACGACTGCCCCAGG + Intronic
1004329087 6:14705137-14705159 TCGGCCACCAAGCCTTCTCTTGG - Intergenic
1004475396 6:15966782-15966804 TGGGCCAGGCAGCCTGCTTCAGG - Intergenic
1006317165 6:33297860-33297882 GAGGCCCGAAATCCTGCTCCTGG + Intronic
1007090490 6:39181474-39181496 CAGACCATCAGGCCTGCTCCGGG - Intergenic
1007359165 6:41342819-41342841 TCCTCCAGCAAGCCGGCTCCTGG - Intronic
1007561053 6:42808726-42808748 TAGGCCTCCAAGACAGCTCCTGG + Intronic
1007696537 6:43737442-43737464 TGGGCCAGCAGCCCTGCTCCAGG + Intergenic
1011259230 6:85454212-85454234 GTGGCCAGCAATTCTGCTCCTGG - Intronic
1013233206 6:108175268-108175290 TAAGCCTGCTAGCCTGCCCCAGG + Intronic
1016269421 6:142271510-142271532 TAATCCAGCAATCCTACTCCTGG - Intergenic
1016416728 6:143841665-143841687 TAGGGAAGAAAGCCTGATCCTGG + Intronic
1016455108 6:144222732-144222754 TAGGGAAGAAAGCCTGATCCTGG - Intergenic
1016528601 6:145033273-145033295 TAGGCCAGAAAAGCTACTCCTGG - Intergenic
1021884859 7:25128665-25128687 TAGGGCACCAAGCAGGCTCCTGG - Intergenic
1022030223 7:26486028-26486050 TGGGCCAGCATGCCTCCACCAGG + Intergenic
1023880855 7:44320757-44320779 GAGGCCAGCAAGAGTCCTCCTGG - Intronic
1024608606 7:51043678-51043700 TTGTCCAGTAAGCCTGCCCCTGG - Exonic
1030090352 7:105852582-105852604 TCGGCCAGCAATCCTGCACAGGG + Intronic
1033036637 7:137881718-137881740 TGGGCCTGCATGCATGCTCCTGG - Intronic
1035022135 7:155806175-155806197 TCGCCCAGCGACCCTGCTCCTGG + Intronic
1036651555 8:10647161-10647183 TAGCCCGTCCAGCCTGCTCCAGG + Intronic
1037448331 8:18990514-18990536 CTGGCCAGCAATCCTTCTCCTGG + Intronic
1037564406 8:20105497-20105519 TAGGCAAGCAAACCTGACCCTGG + Intergenic
1037752381 8:21691328-21691350 TTGGCCAGCAGGCATTCTCCTGG + Exonic
1038248014 8:25877341-25877363 TAGGCTAGCATACCTCCTCCAGG + Intronic
1039346612 8:36712112-36712134 TTTTCCAGCCAGCCTGCTCCTGG + Intergenic
1039804656 8:40987736-40987758 TCTGCCAGCCATCCTGCTCCAGG - Intergenic
1042382552 8:68134659-68134681 TTGGCTCTCAAGCCTGCTCCAGG - Intronic
1048266114 8:132988720-132988742 CAAGCCAGCAAGGCTGCTGCAGG + Intronic
1049435231 8:142583421-142583443 GGGGGCAGCAGGCCTGCTCCTGG - Intergenic
1054933563 9:70662867-70662889 TAGTCCAGCAATCCTGCTACTGG + Intronic
1059747921 9:117220694-117220716 GATGTCAGCAAGCCTCCTCCCGG - Intronic
1060506121 9:124199556-124199578 AAGGCCAGCAGGGCTGTTCCTGG + Intergenic
1060930323 9:127485814-127485836 TGGTCCAGCAGGCCTGTTCCAGG + Exonic
1061228282 9:129294150-129294172 TAACCCAGCAATCATGCTCCTGG - Intergenic
1061615534 9:131776347-131776369 AGAGCCAGCAAGCCTGCTGCAGG - Intergenic
1061947023 9:133914243-133914265 AAGCCCAGCAATCCCGCTCCTGG + Intronic
1062308166 9:135921296-135921318 TCGGCCAGCCATCCGGCTCCTGG + Intergenic
1203563912 Un_KI270744v1:77732-77754 TAGGCCTTCATGCCTGCTTCAGG - Intergenic
1187369650 X:18694297-18694319 TACGACAGCAATCCTACTCCTGG - Intronic
1188668386 X:32852568-32852590 TAGACCATCAAGCAAGCTCCTGG + Intronic
1189662812 X:43321019-43321041 TGGTCCAGCAATCCTGCTACTGG - Intergenic
1190803925 X:53817218-53817240 TAACCCAGCAATCCTGCTTCTGG - Intergenic
1192437759 X:71153370-71153392 TGGCCCAGCAAGCCAGCTCCGGG - Intronic
1192552069 X:72062560-72062582 GTGGCCAGCATGCATGCTCCAGG + Intergenic
1192619434 X:72662562-72662584 TAGCCCAGCAGCCCTGCCCCTGG + Intronic
1195136220 X:101909448-101909470 TAGGGCATCAAGCGGGCTCCTGG + Intronic