ID: 952752828

View in Genome Browser
Species Human (GRCh38)
Location 3:36839316-36839338
Sequence GAAAGCTGCTTTTCTAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 313}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952752828 Original CRISPR GAAAGCTGCTTTTCTAAAAC AGG Intronic
900846638 1:5108564-5108586 GCAAGGCTCTTTTCTAAAACTGG + Intergenic
901714704 1:11144019-11144041 GAAAGCTTCTTCTCTACAAGCGG + Intronic
902171455 1:14614921-14614943 GCAAGTTGCTTTACTAAAATAGG + Intronic
902657495 1:17879389-17879411 GAAAACTGCTGTTTTCAAACGGG - Intergenic
907239525 1:53073741-53073763 GAAAGCTGCTTTTTTAAAAATGG - Intronic
907726390 1:57024523-57024545 GCAAGCTGCTAGTCTAAAAATGG - Intronic
908383784 1:63621118-63621140 AAAAGCTTCTATTCTAAAAATGG - Intronic
909136817 1:71811677-71811699 GAAAACTTCTTCTCTAAAACAGG - Intronic
909303413 1:74041869-74041891 GAAAACTGATATCCTAAAACTGG + Exonic
909900769 1:81131870-81131892 GAATTGTGCTTTTCTAAAACTGG + Intergenic
910705325 1:90123311-90123333 GAAAACAGCTTTCCTTAAACCGG + Intergenic
911197722 1:95012571-95012593 GAAAGCTGTGTATCTCAAACAGG + Intronic
912182206 1:107233145-107233167 GAAAGCTGTTATTCTCAGACAGG - Intronic
912216890 1:107624600-107624622 GAAATTTGCTTTTCTAATACTGG + Intronic
912864434 1:113244784-113244806 GAAAGCTGTTTTACCAACACAGG + Intergenic
913234025 1:116765049-116765071 GAAAACAGCTGTTCTAAAGCAGG + Intronic
913659670 1:120994966-120994988 GAAAGCAACTTTTGTTAAACTGG + Intergenic
914011030 1:143778090-143778112 GAAAGCAACTTTTGTTAAACTGG + Intergenic
914166803 1:145183039-145183061 GAAAGCAACTTTTGTTAAACTGG - Intergenic
914649651 1:149686745-149686767 GAAAGCAACTTTTGTTAAACTGG + Intergenic
915436861 1:155913400-155913422 GAAAACTTCTTGACTAAAACTGG - Exonic
916150256 1:161781270-161781292 TAAAACTAATTTTCTAAAACAGG - Intronic
916618501 1:166470695-166470717 GAAAGCAGCTTTCCAGAAACTGG - Intergenic
917365359 1:174225743-174225765 GAAACCTGTCTTTCTAACACAGG - Intronic
917954536 1:180080336-180080358 GAAAGCTGATTTTTAAAAAAAGG - Intronic
918439891 1:184556250-184556272 GCAGGTTCCTTTTCTAAAACTGG - Intronic
918619612 1:186587700-186587722 GAAAGCTGCTTTTAGAAGAGTGG + Intergenic
919401726 1:197126777-197126799 GTAAACTGTTTTTCAAAAACCGG + Intronic
919644084 1:200075295-200075317 GAAAGCCGCTTTGCAAAAAAAGG + Intronic
920246819 1:204594020-204594042 GAAACCTTCTTTTGCAAAACAGG + Intergenic
921309123 1:213825312-213825334 AAAAGCTGCTTGTCTAAACCTGG + Intergenic
921914070 1:220586921-220586943 GAAAGCAACTTTTTTAAAATGGG - Intronic
923642277 1:235776445-235776467 CAAAGCTGCTTTAATTAAACAGG + Intronic
923643243 1:235787324-235787346 GAAAGCTGTTTTACTAGCACAGG - Exonic
1064343228 10:14506227-14506249 GGAAGCTGCTGTTCTAAAATGGG + Intergenic
1064434510 10:15299544-15299566 TAAAGCTGCTTTTTCAAAACAGG - Intronic
1064547048 10:16461522-16461544 GAAAGCTGATTTACTACAATGGG - Intronic
1066424040 10:35289571-35289593 GAATGTTGCTTTTAAAAAACTGG + Intronic
1069214626 10:65804175-65804197 GACAGGTGATTTTCTAAAAATGG - Intergenic
1071357255 10:84810574-84810596 CAGAGCTTTTTTTCTAAAACAGG + Intergenic
1071588004 10:86844232-86844254 AAAAACTGCTTTTGTAAAAGAGG - Intronic
1071837402 10:89432309-89432331 GAAAGCTCTTTTCCTAAGACTGG - Exonic
1072691420 10:97574564-97574586 CAGAGCTGCTTTCCTAAAATAGG - Intronic
1073491930 10:103858230-103858252 AAAATCTGATTTTCGAAAACAGG + Intergenic
1073564537 10:104523896-104523918 GTAACCTGCTTTAATAAAACTGG - Intergenic
1074403639 10:113162781-113162803 GAAGGATGCTATTCCAAAACAGG + Intronic
1074707462 10:116147734-116147756 GAAAGCTCCTTTCCTAGAACTGG + Intronic
1075661130 10:124197231-124197253 TAAAGTTGCTTTTCTTGAACCGG - Intergenic
1079815055 11:25045878-25045900 GAAATCTCCTTTACTAAAATTGG - Intronic
1080215523 11:29835706-29835728 GAAAACTTCTCTTCTACAACAGG - Intergenic
1080279273 11:30537974-30537996 GAAAACTACTTTTCAAAGACAGG - Intronic
1081595996 11:44460012-44460034 GAGGGCAGCTTTTCTAACACTGG + Intergenic
1085134701 11:74075682-74075704 GAAAACTGGTTATCTAAAACAGG - Intronic
1086538434 11:87878596-87878618 GGAAATTGCTTTTTTAAAACTGG - Intergenic
1090193644 11:124796867-124796889 TAAATCTGCATTTCTGAAACTGG + Intronic
1090641490 11:128732987-128733009 CAAAGCTGCTTTCTCAAAACAGG + Intronic
1092832438 12:12457848-12457870 GACAGCTGCTTCCCTGAAACAGG + Intronic
1095423676 12:42052086-42052108 CAAAGCTACTTTTCTAAGAGGGG - Intergenic
1097578887 12:61429272-61429294 CAAAGCTACTTCTATAAAACTGG + Intergenic
1097987868 12:65803367-65803389 GAAAGCTGATTGTCTCAAAGTGG - Intergenic
1100807805 12:98305497-98305519 GTAAGCTGCTTTACTCAAAAAGG - Intergenic
1101637325 12:106555313-106555335 GATAGCTGCTTTTTTATACCAGG - Intronic
1105370305 13:19796243-19796265 GCAAGGTTCTTTGCTAAAACTGG + Intergenic
1105390789 13:19976026-19976048 GATTGCTGTTTTTCTAAAAAAGG - Intronic
1105549107 13:21376184-21376206 GAAAACTGCTTTTTTAAATTGGG - Exonic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1108782765 13:53856891-53856913 GCAAGCTGTTTTTCAAAAAAGGG - Intergenic
1108993653 13:56696662-56696684 GAAGACTGATTTTCTAAAATTGG + Intergenic
1109718997 13:66253423-66253445 AAAAAATGCTGTTCTAAAACAGG + Intergenic
1109805753 13:67440499-67440521 GAGAGCTGCTTTTCAGAAATTGG + Intergenic
1109916075 13:68986570-68986592 GAAAACTGCTTTTTTAAATTGGG + Intergenic
1111610883 13:90604634-90604656 TTAAGCTGCTTTTCCAAAAATGG - Intergenic
1113070621 13:106417268-106417290 GATAGTTGTTTTTCTAAATCAGG + Intergenic
1113409720 13:110074076-110074098 GAAAGCTTCTTTTCTACTGCAGG - Intergenic
1114799643 14:25759229-25759251 GAAAGCTGTTTTCAGAAAACTGG + Intergenic
1115126190 14:29997273-29997295 GTAACCTGTGTTTCTAAAACAGG + Intronic
1115397966 14:32931592-32931614 GAAACTTTGTTTTCTAAAACAGG - Intergenic
1116283059 14:42933985-42934007 GAAAACTGCCTTTCTAAAAGTGG + Intergenic
1116988624 14:51248724-51248746 GAAACATGCCTTTTTAAAACTGG + Intronic
1117499088 14:56334095-56334117 GGAAGCTTGTTTTCAAAAACTGG + Intergenic
1119034197 14:71215917-71215939 GAAACCTGCTGTGCTTAAACCGG + Intergenic
1120995077 14:90411185-90411207 GAAAAATGCTTTTGTAAAAATGG - Intergenic
1123229375 15:17085692-17085714 GATATTTGCTTTTCCAAAACAGG - Intergenic
1123231776 15:17128150-17128172 GATATTTGCTTTTCCAAAACAGG - Intergenic
1123232012 15:17132239-17132261 GATATTTGCTTTTCCAAAACAGG - Intergenic
1123233784 15:17162780-17162802 GATATTTGCTTTTCCAAAACAGG - Intergenic
1123234521 15:17175549-17175571 GATATTTGCTTTTCCAAAACAGG - Intergenic
1123235997 15:17201066-17201088 GATATTTGCTTTTCCAAAACAGG - Intergenic
1123237499 15:17227127-17227149 GATATTTGCTTTTCCAAAACAGG - Intergenic
1123238237 15:17239860-17239882 GATATTTGCTTTTCCAAAACAGG - Intergenic
1123238483 15:17244115-17244137 GATATTTGCTTTTCCAAAACAGG - Intergenic
1123239632 15:17264074-17264096 GATATTTGCTTTTCCAAAACAGG - Intergenic
1123240859 15:17285344-17285366 GATATTTGCTTTTCCAAAACAGG - Intergenic
1123241368 15:17293858-17293880 GATATTTGCTTTTCCAAAACAGG - Intergenic
1123243349 15:17327855-17327877 GATATTTGCTTTTCCAAAACAGG - Intergenic
1123243684 15:17333661-17333683 GATATTTGCTTTTCCAAAACAGG - Intergenic
1123245675 15:17368416-17368438 GATATTTGCTTTTCCAAAACAGG - Intergenic
1123246658 15:17385498-17385520 GATATTTGCTTTTCCAAAACAGG - Intergenic
1123248456 15:17417084-17417106 GATATTTGCTTTTCCAAAACAGG - Intergenic
1123250402 15:17451167-17451189 GATATTTGCTTTTCCAAAACAGG - Intergenic
1123250922 15:17460201-17460223 GATATTTGCTTTTCCAAAACAGG - Intergenic
1123251103 15:17463441-17463463 GATATTTGCTTTTCCAAAACAGG - Intergenic
1123251350 15:17467708-17467730 GATATTTGCTTTTCCAAAACAGG - Intergenic
1123251598 15:17471959-17471981 GATATTTGCTTTTCCAAAACAGG - Intergenic
1123252823 15:17493614-17493636 GATATTTGCTTTTCCAAAACAGG - Intergenic
1124912071 15:33931181-33931203 GAAAGCTGCCTTTCTTAACAAGG - Intronic
1124950173 15:34310926-34310948 GAAAGCTTATGTTCTAAAAAAGG - Intronic
1125782853 15:42286029-42286051 GAAAGCTGTTTTACTAAAAATGG + Intronic
1126082131 15:44973892-44973914 TACATCTGCTTTTCTACAACTGG - Exonic
1128154334 15:65383385-65383407 GAAAGCGGATTTTCAAAACCAGG + Exonic
1134137169 16:11685051-11685073 GAAATTTGCTTTTCAAAAAATGG + Intronic
1134417241 16:14054825-14054847 GAAACCCTCTGTTCTAAAACTGG - Intergenic
1134844578 16:17429069-17429091 AAATGCTGCTTTTCAAAGACGGG - Intronic
1135773653 16:25236867-25236889 CTATGCTGCTTTTCAAAAACAGG + Exonic
1136698520 16:32109477-32109499 GAAAGCATATTTTCTAAAATAGG - Intergenic
1136799023 16:33052771-33052793 GAAAGCATATTTTCTAAAATAGG - Intergenic
1138701203 16:58865369-58865391 GAAAGCTTCTGTTTTAAAACTGG + Intergenic
1139028148 16:62845232-62845254 GAAATCTTCAATTCTAAAACTGG - Intergenic
1139762546 16:69197642-69197664 GAATGCTACTTTGTTAAAACTGG - Intronic
1140631256 16:76855155-76855177 GAAAGCAGCTCTTCGTAAACAGG + Intergenic
1144284918 17:13764532-13764554 GATAACTACTTCTCTAAAACAGG - Intergenic
1144359608 17:14479414-14479436 GAAGGCTCCTTCTCAAAAACTGG - Intergenic
1147202834 17:38814954-38814976 GCAGGCTGCTCTTCTGAAACAGG - Exonic
1148033962 17:44643856-44643878 GAAAGCTGATGGTCTAGAACGGG + Intergenic
1149168998 17:53787462-53787484 GCTAGCTGCTTTTCTAAAACAGG + Intergenic
1149896888 17:60435327-60435349 TAAACCTGCTTTTCCAAAGCCGG - Intergenic
1150265394 17:63829270-63829292 GAAGGCTGCTTGTCCAATACTGG - Intronic
1150764463 17:67992724-67992746 AAAAGCAGCTTTTCTAAACTCGG + Intronic
1151226223 17:72650262-72650284 GAAAGCAGCTTCTCAAAGACAGG - Intronic
1151690108 17:75678662-75678684 GGAATCTGCTCTTCCAAAACCGG - Intronic
1154535702 18:15407282-15407304 GAAAGTTCCTTTTCTACCACAGG - Intergenic
1155279404 18:24223344-24223366 GAAAGCTACTTTTTAAAAATAGG + Intronic
1155296875 18:24392694-24392716 GTTAGCTGCTTTTTTGAAACAGG + Intronic
1155706425 18:28820675-28820697 GAAAGCTTTTCCTCTAAAACTGG - Intergenic
1158770751 18:60514332-60514354 GTAAGCTGCTTCTCCACAACTGG + Intergenic
1159583198 18:70256614-70256636 GAAAGCTGCCTTTCTCACTCTGG + Intergenic
1159926824 18:74277217-74277239 GGATGCTGTTTTTCTAAGACGGG + Intronic
1164063764 19:21696530-21696552 GAATGCAGATTTTCTAACACAGG - Intergenic
1164187545 19:22883915-22883937 GGAAGTTGCTTTTCTAATTCTGG - Intergenic
1164793723 19:31009333-31009355 GCAAGGTGCTGTTCTAGAACTGG - Intergenic
1164820676 19:31248894-31248916 AAAACCTTCATTTCTAAAACAGG + Intergenic
1167916835 19:52747357-52747379 GTAAGCTGCTTTTCTATTGCTGG + Intergenic
1167990886 19:53359588-53359610 GTAAGCTGCTTTTCTATTGCTGG - Intergenic
1168214247 19:54913616-54913638 TAAAGCTGCTTCTCTACAACTGG - Intronic
925132434 2:1503353-1503375 TACAGCTTCTTTTCTAAAACTGG + Intronic
925697164 2:6593149-6593171 GAAAGGTATTTTGCTAAAACTGG - Intergenic
927051288 2:19331823-19331845 GAAAGCTGAATTCATAAAACAGG + Intergenic
927416178 2:22882955-22882977 TAGAACTGCTTTTCTAAGACAGG - Intergenic
928924117 2:36559487-36559509 GAAAGCTGCTTTACAGTAACTGG + Intronic
929033054 2:37666720-37666742 GAAAACTGCTTTTCTACCAGAGG + Intronic
929303965 2:40338393-40338415 TAAAGCTTCTTTTCTATAACTGG + Intronic
929384594 2:41390368-41390390 GAAAGCAGGTTTTCCAAAGCTGG + Intergenic
929902623 2:46018698-46018720 GACATGTACTTTTCTAAAACTGG - Intronic
931820980 2:65951973-65951995 GCAAGCTGCTTTACTGGAACTGG - Intergenic
932521275 2:72416071-72416093 GAAAGCTGCTGTGCTAGAAGAGG - Intronic
932966502 2:76481410-76481432 GAAAGTTTCTTTCCTAAAATGGG - Intergenic
934742592 2:96736007-96736029 GAAAGCTATTTTTTTGAAACAGG - Intronic
935037897 2:99396653-99396675 GAAAGCTGCTTTCCTCTAATGGG + Intronic
936381063 2:111986527-111986549 GAAAGCTGCTTTTCTGAAGGGGG + Intronic
936554555 2:113483445-113483467 AAAAGCTGCGTTTCTCAAATGGG + Intronic
937035625 2:118779315-118779337 GAAAGCTGCTATTTGAAAAGGGG + Intergenic
937054433 2:118921207-118921229 GGAAGATTCTGTTCTAAAACAGG + Intergenic
940110799 2:150150917-150150939 GAAAACTGATTTTCTAAGAAAGG + Intergenic
941924957 2:170885415-170885437 AAATGCTGCCATTCTAAAACGGG - Intergenic
943969517 2:194385786-194385808 GAAAGCTTTTTTTTAAAAACAGG - Intergenic
944536224 2:200713174-200713196 AAAAGCTGCTTTTGTAAAACTGG - Intergenic
945188449 2:207163540-207163562 GAAACCTGCTTTTCTAGATCTGG - Intronic
945201477 2:207286078-207286100 GAAAGCTTCCATTCCAAAACAGG + Intergenic
946344725 2:219099952-219099974 GCAAGCTGTATTTCTGAAACTGG + Intronic
946378812 2:219330929-219330951 GGAAGCTGCTTCTCTTCAACTGG - Intronic
946536632 2:220636701-220636723 CAGAGCTGCCTTTCTAAAATTGG - Intergenic
946912810 2:224483840-224483862 GAAATTTGCTTTTGAAAAACAGG - Intronic
947015217 2:225612002-225612024 GAATGTGACTTTTCTAAAACTGG - Intronic
947181338 2:227413944-227413966 GAAATCTCCTTTACAAAAACAGG - Intergenic
947377847 2:229515215-229515237 GAAAGGTATTTTTTTAAAACAGG + Intronic
949061660 2:241962451-241962473 GACACCTGCTTTTATCAAACCGG - Intergenic
1169865198 20:10192343-10192365 GAAAGCAGCTTTTAGAAAATTGG - Intergenic
1170182040 20:13542542-13542564 GAAACTTTCTTTTCTAAAATTGG - Intronic
1170275825 20:14585760-14585782 CAAAGCTGTTTTTCAAATACAGG + Intronic
1170490210 20:16864787-16864809 GAAAGAAGGTTTTCTAAACCAGG + Intergenic
1170522582 20:17202839-17202861 GAGAGCTGCTTTGCTTATACAGG + Intergenic
1170555984 20:17514996-17515018 GAGAACTGCTCTTCTAGAACAGG - Intronic
1170580148 20:17692954-17692976 ATAAGCTGGTTTTCTAAAAATGG + Intergenic
1170776927 20:19383231-19383253 GACAGCTGCTATTCTATCACTGG + Intronic
1171316801 20:24202590-24202612 TAAAGCTAATTTTCTCAAACTGG - Intergenic
1171945501 20:31373577-31373599 AAAAGCTTTTTTTCTAGAACAGG + Exonic
1172753588 20:37268212-37268234 GAAAGCAGCTTTTACAAAGCAGG - Intergenic
1174439399 20:50537659-50537681 GGTAGCTGCTTTCTTAAAACAGG - Intronic
1176674931 21:9768772-9768794 GAATGCTGCTTTTAATAAACAGG + Intergenic
1177248652 21:18564494-18564516 GTAAGCTGCTTTTCTATTGCTGG + Intergenic
1177340732 21:19796212-19796234 GCAAGCTGCTTTTAAAAAATAGG - Intergenic
1178174318 21:30078619-30078641 GAAGGCTGCTTTTCAGAAAAGGG - Intergenic
1178872530 21:36388250-36388272 GAAAGCAGCTGTTTTCAAACAGG - Intronic
1179418526 21:41217454-41217476 GGAAGTTGCTTGGCTAAAACGGG - Intronic
1179772579 21:43633789-43633811 GAAAGCAACATTTCTAAGACAGG + Intronic
1180235184 21:46454745-46454767 GAATCCTGATTTTTTAAAACTGG + Intergenic
1182572876 22:31251937-31251959 GAAAGAAGCTTCTCTACAACTGG + Intronic
1182665173 22:31953125-31953147 CAAAGCTGCTTCTGTGAAACTGG - Intronic
1183849484 22:40572552-40572574 TAAAGCTGTTTTTTTAAAAAAGG + Intronic
1184546780 22:45175677-45175699 CAAAGCTGCTTTCCTGAAACAGG - Intronic
1185154440 22:49184590-49184612 GAGAGCTGCTTTGCTAACGCTGG - Intergenic
949187416 3:1209303-1209325 GAAAGCTGCTTTTCACATAATGG - Intronic
950944205 3:16927965-16927987 GCAAGCTGCCTTTGAAAAACGGG - Intronic
951280358 3:20741363-20741385 CAGATCTGCTTTTCAAAAACTGG + Intergenic
951694732 3:25434254-25434276 GAAATCTGCTTTTGGAAATCAGG - Intronic
952752828 3:36839316-36839338 GAAAGCTGCTTTTCTAAAACAGG + Intronic
953869290 3:46612451-46612473 GAGAGTTGCTTTTTTAAAAGAGG - Intronic
957050861 3:75410868-75410890 AAACGCTGGTTGTCTAAAACGGG + Intergenic
957941347 3:87008416-87008438 GAGACCTACTTTTGTAAAACAGG + Intergenic
958079602 3:88729261-88729283 GTAAGTTGCTTTTCTTAAAAAGG + Intergenic
959516609 3:107274212-107274234 GAAGGCTGCTTTTCTAGCAAGGG - Intergenic
959770597 3:110090527-110090549 GCAGGGTTCTTTTCTAAAACTGG + Intergenic
960163342 3:114374156-114374178 GAAAGGTGACTTTTTAAAACGGG + Intronic
960173130 3:114486458-114486480 GAAAGGTACTGTTATAAAACTGG + Intronic
960511410 3:118553536-118553558 CAAAGCTGCTTTAATAAAATGGG - Intergenic
960924934 3:122785352-122785374 GCAAGGTTCTTTCCTAAAACTGG - Intronic
961298518 3:125906107-125906129 TAAAGCTGCTTTTTAATAACAGG - Intergenic
962536603 3:136334713-136334735 GAAAGATGCTCTTCAAAAAGTGG + Intronic
963601440 3:147382156-147382178 AAAGGCTGTTTTTCTACAACAGG + Intergenic
963878810 3:150504763-150504785 GTAATCTGCTTTTCTGAAGCTGG + Intergenic
964311604 3:155399697-155399719 GAGAACTGCTTATCTAAATCTGG - Intronic
966212706 3:177469544-177469566 GAAGTCTGCTTTTCTAAGACAGG + Intergenic
967305347 3:188053649-188053671 GAAAGCTGCTTTTCTTTTAGGGG - Intergenic
967465764 3:189804379-189804401 GAATGGTGCTTTTCTAAGATAGG - Intronic
967485126 3:190021507-190021529 GAAAGTTACTTTTTTAAAAAAGG - Intronic
969259824 4:6026152-6026174 AAATGATGATTTTCTAAAACAGG - Intergenic
969821582 4:9724825-9724847 AAACGCTGGTTGTCTAAAACGGG - Intergenic
969934290 4:10665889-10665911 CAAAGATGCTTTTCCCAAACAGG - Intronic
970174360 4:13323714-13323736 GGAAAATGCTTTTCTAAGACTGG + Intergenic
970188575 4:13487759-13487781 GAAAGATGCTTTTCCAAATAAGG - Intergenic
970303536 4:14706610-14706632 GAATGCTGCTTTTTTTAAAGGGG - Intergenic
971498855 4:27297095-27297117 GAGAGCTGCTTTTATACAAATGG - Intergenic
971862267 4:32123063-32123085 GATAGCTTCTTTTGAAAAACAGG + Intergenic
974533246 4:63140101-63140123 AAAAGCTGTTATTTTAAAACTGG - Intergenic
975651254 4:76595831-76595853 GAAACTTGCTTATCTAAAACAGG - Intronic
977100821 4:92812589-92812611 TAAAGTTGCTTTATTAAAACAGG - Intronic
978830146 4:113073961-113073983 GAAAAGTGCTTTTCTGAAAAAGG + Intronic
978926182 4:114248437-114248459 GAAAGGTTCTTTGCTAAAACTGG - Intergenic
980565018 4:134528361-134528383 TAATGTTGCTTTTCTAAATCAGG + Intergenic
981732449 4:147913851-147913873 GCAAGCTGATTTTTTTAAACAGG - Intronic
981749465 4:148079987-148080009 AAAATCTGATTTTCTAAAATGGG + Exonic
982206804 4:153002660-153002682 GAAACCAGCTTTTCTGAACCAGG - Intergenic
982690456 4:158542240-158542262 GAATGATGCTTTTCTAATCCAGG + Intronic
982896704 4:160938862-160938884 GCAAGCTGCTTGTATAGAACTGG + Intergenic
983038460 4:162896177-162896199 CAAAGCTGCTTTCCTTAAATGGG - Intergenic
984133408 4:175906459-175906481 GAAGGCTTGTTTTCTAAAATTGG - Intronic
985377484 4:189356170-189356192 GGAAGATGGTTTTCTAAGACCGG + Intergenic
985400624 4:189589923-189589945 GAATGCTGCTTTTAATAAACAGG - Intergenic
988236575 5:28552960-28552982 GAAAGCTTCTCTTCTAAGATCGG - Intergenic
988336550 5:29915054-29915076 GAATGCTGGCTTTCTAAAATAGG + Intergenic
989540568 5:42613550-42613572 GAAAGCGTCATTTCAAAAACAGG + Intronic
990812047 5:59737900-59737922 TAATGCTGCCTTTGTAAAACCGG - Intronic
990832036 5:59970145-59970167 GAAAGCTTCTCTTTTAATACTGG - Intronic
991512372 5:67393892-67393914 GAAAGCTTCTTTTGCAATACAGG - Intergenic
992349435 5:75913733-75913755 GACAGCTCCATTTCTGAAACAGG - Intergenic
992629174 5:78664345-78664367 AAAGGCTGCTTTTCTAGGACTGG + Intronic
992834371 5:80625300-80625322 GCAAGATGCTTTTCTTACACAGG - Intergenic
993517374 5:88855310-88855332 TAATGATGCTTTTCTAAAAATGG - Intronic
995555348 5:113322638-113322660 GATAGCTGATTCTTTAAAACAGG - Intronic
996474576 5:123902358-123902380 GAAAGCAGATTTTAGAAAACAGG + Intergenic
996552962 5:124748887-124748909 GAGAGCAGCTTTTATGAAACTGG + Intergenic
996620618 5:125497655-125497677 GGAAGCTGTGTTTCTAAATCTGG - Intergenic
996693331 5:126365463-126365485 GAATGCTGCTTTTTAAAATCTGG + Intronic
996827578 5:127702928-127702950 GAAAGCTTCTTTCCTAACACAGG - Intergenic
997603000 5:135153198-135153220 GAAAGCTGCTTTGGTTAAAATGG + Intronic
998954646 5:147426646-147426668 GAAAGCTGACGTTCTCAAACAGG - Intronic
1000259335 5:159571692-159571714 CATAGCTGCTTTGCAAAAACTGG - Intergenic
1000849189 5:166319137-166319159 GAAAGCTGCTTTTAAAATATAGG - Intergenic
1002910268 6:1485762-1485784 TAAAGCTGTTTTTTAAAAACAGG + Intergenic
1004729735 6:18345984-18346006 GTAAGATGCTTTTCAATAACAGG - Intergenic
1006656575 6:35599078-35599100 AAATGCTTCTTTTCTAACACTGG + Intronic
1009375490 6:62963179-62963201 GGAAGCTGAGTTTCTGAAACTGG - Intergenic
1010051678 6:71511892-71511914 AAAAGCTGCTTTGCTAAGACTGG + Intergenic
1011045655 6:83079178-83079200 TAAAGATGCTTTTTTAAAAAAGG - Intronic
1013713508 6:112930029-112930051 GAGAGGTGCTTTTCAAAAAGGGG + Intergenic
1014897148 6:126915942-126915964 GAATGCTGACTTTCCAAAACAGG + Intergenic
1015055139 6:128892918-128892940 GAAAACTGCTTTTCTAAACTTGG + Intronic
1016983168 6:149871876-149871898 AAAACCTGCTTTTCAAAAACTGG - Intergenic
1017967443 6:159278507-159278529 CAAAGCTGCTTTTCTCAGAAAGG - Intergenic
1018386398 6:163307965-163307987 GAAAACTCTTATTCTAAAACAGG + Intronic
1020317168 7:6914035-6914057 AAACGCTGGTTGTCTAAAACGGG + Intergenic
1020357825 7:7296766-7296788 TAAAGCTGCTTTTTCAAATCTGG - Intergenic
1020742336 7:12037846-12037868 GAAAGATGCTTTTCTATACCTGG - Intergenic
1021586079 7:22210057-22210079 GAAAACTTTATTTCTAAAACTGG - Intronic
1021895057 7:25225676-25225698 GAAAGCTGCTTTTGAAAGGCAGG + Intronic
1022343279 7:29488111-29488133 GAGAGCTGAGTTTCTCAAACCGG - Intronic
1022689592 7:32634970-32634992 GAAAAATGTTTTTCTAAAACAGG - Intergenic
1022856280 7:34317967-34317989 GAAACCTGCTTTTATATAGCCGG - Intergenic
1023279078 7:38551556-38551578 GAAAGTTTCTTCTCTAATACTGG - Intronic
1024635819 7:51289431-51289453 CAGAGCTTGTTTTCTAAAACAGG + Intronic
1024663379 7:51520879-51520901 GAAAGCTGCTTTTATACAAAGGG - Intergenic
1025310510 7:57932685-57932707 GATATATGCTTTTCCAAAACAGG + Intergenic
1025313819 7:57990780-57990802 GATATTTGCTTTTCCAAAACAGG + Intergenic
1028525234 7:91777275-91777297 GAAAGCTGCCTCTCTCAGACTGG - Intronic
1029021535 7:97369840-97369862 GAAAGCTGATTCTCTGAAAAAGG - Intergenic
1030335803 7:108324564-108324586 GACACCTGCTTTTCTTCAACAGG + Intronic
1030594448 7:111520348-111520370 AAAAGCTACATTTTTAAAACAGG - Intronic
1030892009 7:115009956-115009978 GAAAGATGCCTGTCCAAAACTGG - Intronic
1032800488 7:135313771-135313793 GAAATCTGCTTTTCCTAAAGTGG + Intergenic
1034910239 7:154990901-154990923 GAAAATAGCTTCTCTAAAACTGG + Intronic
1037516790 8:19639701-19639723 GAGAGCTGCTTTTCTTAATCAGG + Intronic
1038075188 8:24065328-24065350 GAAAACAGCTTTTGTGAAACCGG + Intergenic
1038120940 8:24614522-24614544 TAAAGCTGCTTTTCAAAAGGAGG - Intergenic
1038803948 8:30773792-30773814 GAATGCTGCTTTTCTAACTAAGG - Intergenic
1039466037 8:37786191-37786213 GAAACCTGATCTTCTAAGACTGG + Intronic
1039662689 8:39484103-39484125 GAAAAGGGCCTTTCTAAAACTGG + Intergenic
1039766508 8:40633880-40633902 CTAAGCTGCTTTCCGAAAACGGG - Intronic
1041250492 8:55929803-55929825 TAAATCTGCTTCTCTACAACAGG - Intronic
1042406163 8:68407917-68407939 GAATGTTCCTTTTATAAAACAGG - Intronic
1042762641 8:72287323-72287345 AAAAGCTGTTATTCTAAAAGTGG - Intergenic
1043631252 8:82337509-82337531 AAAAGGTTCTTTACTAAAACTGG - Intergenic
1045832080 8:106474453-106474475 GATAGCTGCAATTCTAAATCTGG + Intronic
1047141472 8:122145404-122145426 GAAAGCTAGTTTTATAAAAAGGG - Intergenic
1048080941 8:131126023-131126045 AAAAGCTGCTTTTTAAAAAGTGG - Intergenic
1048187294 8:132253018-132253040 GAAAGGTGCTTTTCCAGAAATGG - Intronic
1048420918 8:134277599-134277621 GAAAGCTGTTTTTCCAAATGTGG - Intergenic
1048567320 8:135615150-135615172 GCAAGGTTCTTTTTTAAAACTGG + Intronic
1049128283 8:140811824-140811846 GAAAGCTGTCTTTCTGAAATAGG + Intronic
1049898455 9:133740-133762 AAAAGCTGCGTTTCTCAAATGGG - Intronic
1050048942 9:1577562-1577584 TCAAGCTACATTTCTAAAACTGG - Intergenic
1050593645 9:7184550-7184572 AAAAACTGCTCTTCAAAAACTGG + Intergenic
1050988271 9:12110956-12110978 GAAAGTTGTTTTGCTGAAACTGG - Intergenic
1052156562 9:25199784-25199806 TAAAGCTGCTTCTAGAAAACAGG + Intergenic
1052305087 9:26999447-26999469 GAAGGCTGCTTTTGTCAAATTGG + Intronic
1052679380 9:31669421-31669443 GAATGATGCATTTCTAATACAGG + Intergenic
1057144633 9:92749585-92749607 CTAAGCTGCTTTTAGAAAACTGG + Intronic
1057583532 9:96308959-96308981 TCAAGCTGTTTTTTTAAAACTGG + Intergenic
1057887084 9:98838172-98838194 GAAGCTTCCTTTTCTAAAACAGG + Intronic
1058183203 9:101822948-101822970 GAAAGATGTTTTTCTAAAATTGG + Intergenic
1059961801 9:119572629-119572651 CAAAGATGTTTTTCTAAAAGAGG - Intergenic
1060089513 9:120730787-120730809 GAGAGCTGCTCTTCTGAATCAGG - Intergenic
1060570885 9:124638946-124638968 GGAAGCTGATTTTCTAAAAAGGG + Intronic
1203374718 Un_KI270442v1:358093-358115 GATATTTCCTTTTCTAAAACTGG - Intergenic
1186833655 X:13416421-13416443 GACAGTGGTTTTTCTAAAACAGG - Intergenic
1187440129 X:19310804-19310826 GAAAGGTTCTTTTCTTCAACAGG - Intergenic
1187500396 X:19833849-19833871 GGATGCTCCTTTCCTAAAACTGG + Intronic
1187772671 X:22718405-22718427 GATTGATTCTTTTCTAAAACAGG + Intergenic
1188512751 X:30954215-30954237 GATAGATGCTGTTCTAAAAATGG + Intronic
1192991349 X:76460940-76460962 GAAAGCTGAAATTATAAAACAGG + Intergenic
1195145536 X:102011722-102011744 GATAGCTGGTTGTCTAGAACAGG + Intergenic
1195972991 X:110493997-110494019 GAAAACTGTTTTTCAAAAAAGGG - Intergenic
1196078155 X:111600373-111600395 GAAGGGTTCTTTGCTAAAACTGG - Intergenic
1196882662 X:120212763-120212785 GAAAGTAGCTTTTCTGCAACAGG - Intergenic
1197145959 X:123172559-123172581 GAAAGCTGCAATTATAAAAAAGG + Intergenic
1197384610 X:125787701-125787723 GGAAGTTGCTTTTCTAATTCTGG + Intergenic
1198661133 X:138968742-138968764 GCAAGCTGATTTTCTGAAAGAGG + Intronic
1198738884 X:139819606-139819628 GAAAGCTTCATTTCTGAAAAAGG - Intronic