ID: 952752844

View in Genome Browser
Species Human (GRCh38)
Location 3:36839438-36839460
Sequence CTAAGTGGCACATGCTGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952752835_952752844 20 Left 952752835 3:36839395-36839417 CCCAGCATGTACACATTAGGTCT 0: 1
1: 0
2: 0
3: 2
4: 92
Right 952752844 3:36839438-36839460 CTAAGTGGCACATGCTGATAAGG 0: 1
1: 0
2: 0
3: 14
4: 116
952752836_952752844 19 Left 952752836 3:36839396-36839418 CCAGCATGTACACATTAGGTCTC 0: 1
1: 0
2: 1
3: 5
4: 68
Right 952752844 3:36839438-36839460 CTAAGTGGCACATGCTGATAAGG 0: 1
1: 0
2: 0
3: 14
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952752844 Original CRISPR CTAAGTGGCACATGCTGATA AGG Intronic
900492878 1:2961389-2961411 CTGAGTGGCACATGCTGGTGTGG + Intergenic
902422196 1:16289730-16289752 CTATGTTGCCCATGCTGTTAGGG - Intronic
906793753 1:48680585-48680607 TTCAGTGGCACATGCTGAAAAGG + Intronic
910281243 1:85503836-85503858 CTAAGTGGCAGGTGATGATGGGG + Intronic
911428384 1:97751561-97751583 CTATGTTGCCCAGGCTGATATGG - Intronic
912026417 1:105179955-105179977 CTATGTTGCACATGCTGGGATGG - Intergenic
917106659 1:171499008-171499030 CTAAGTTGCACAGGCTGATCTGG + Intronic
917350792 1:174075595-174075617 CTAAGTGGCACATGTTGTGCTGG - Intergenic
918985907 1:191625034-191625056 CTATTTGGCACATACTTATAAGG + Intergenic
921422058 1:214959626-214959648 CTAAGTGGCATAAAGTGATATGG + Intergenic
923320971 1:232832716-232832738 CTAAGAAACACATGCAGATATGG + Intergenic
1065964789 10:30762342-30762364 CTAAGAGGTCCATGCTGATGTGG + Intergenic
1068873901 10:61976562-61976584 CGAAGTGGTACATACTGATGGGG + Intronic
1070447948 10:76526340-76526362 CTAAAATGCACATGCTGAAAAGG - Intronic
1073333869 10:102690025-102690047 CTAATTGGAATATGCTGATTGGG - Intronic
1073936543 10:108639466-108639488 TTCAGAGGCACATGCTGAGATGG - Intergenic
1075600645 10:123766180-123766202 ATGAGTGTCACATGCTGACATGG + Intronic
1079346042 11:19653122-19653144 CCAAGTGTCACATGCTATTAAGG - Intronic
1084985283 11:72864826-72864848 CTGAGTGACACAGGCTGATGGGG + Intronic
1086537907 11:87870790-87870812 CTAAGTCCCATATGATGATAAGG - Intergenic
1087123877 11:94603921-94603943 CTTAGTAGCACATACTTATATGG - Intronic
1089828583 11:121303082-121303104 CTAAGTGGCACAAGCCCAGATGG - Intronic
1091340712 11:134810987-134811009 CTATGTGGCACAGCCTGCTAAGG + Intergenic
1091601363 12:1919407-1919429 CTTAGTGGGATATGCTGACATGG + Intergenic
1092672278 12:10877465-10877487 CTAAGTGTCACATGCTTTAAGGG + Intronic
1094051483 12:26225939-26225961 CTAAGGTGCAGATGCTGAGATGG - Intronic
1095939155 12:47714761-47714783 CTAAGTGGAAGATGTTGAGAAGG + Intronic
1097945374 12:65362230-65362252 CTAAGTGGCATATCCTTATGTGG + Intronic
1098238968 12:68446677-68446699 AAAACTGGAACATGCTGATAAGG - Intergenic
1098392023 12:69979637-69979659 CAAAGTGGCAGATTCTGAGATGG + Intergenic
1098628816 12:72704108-72704130 AAAAGTGGGACTTGCTGATAAGG - Intergenic
1100283315 12:93139371-93139393 CTAAGTAGCACAAACTGACAAGG - Intergenic
1101321137 12:103673963-103673985 CTCACTGGCACATGCAGAGACGG + Exonic
1109008867 13:56913664-56913686 CTATGTAGCACATGCGGACAAGG + Intergenic
1115073627 14:29358634-29358656 TTAAGTAGCACATGCTAGTAGGG - Intergenic
1115369799 14:32600477-32600499 CTGAGTGACAAATGCTGATATGG + Intronic
1115912587 14:38272821-38272843 CTTAGTGGGACATGCTGAGTTGG - Intergenic
1117137090 14:52746226-52746248 CTATGTTGCCCAGGCTGATAAGG - Intronic
1118719519 14:68584199-68584221 CCAAGTGGCACAGGCTGGTGGGG - Intronic
1118970730 14:70635312-70635334 GTCAGTGGCACATGCATATATGG - Intergenic
1120316903 14:82905905-82905927 CTAAGTGGCAAAGGCAGATGAGG + Intergenic
1120984337 14:90320533-90320555 CTAAGATGCAAATACTGATATGG - Intronic
1121732459 14:96195978-96196000 CTATGTGGCTAATGCTGCTAGGG - Intergenic
1125583867 15:40806811-40806833 CTAACTAGCACATGCTGAGAAGG + Intronic
1134683141 16:16140534-16140556 CTAAGTGGCAGATGCTGAGTTGG + Intronic
1137868262 16:51923929-51923951 CTAAGTGGAACATGCCGCCAAGG + Intergenic
1137975744 16:53030394-53030416 AAAACTGGCAAATGCTGATAGGG + Intergenic
1139087385 16:63603524-63603546 CTAAGTGGGATATGCAGAAAAGG + Intergenic
1139265641 16:65635953-65635975 GTATGTGGCACATGTTGAGAGGG - Intergenic
1141505084 16:84471619-84471641 CTTTGCCGCACATGCTGATATGG + Intergenic
1141960243 16:87401472-87401494 CTAACTGGCACATGCCAAAATGG - Intronic
1148291211 17:46451873-46451895 CTAAGTAGCATAAGCAGATATGG - Intergenic
1148313398 17:46669576-46669598 CTAAGTAGCATAAGCAGATATGG - Intronic
1149023182 17:51993890-51993912 CTAAGTGCCAGATGCTGTGATGG + Intronic
1149096750 17:52851031-52851053 ATAAGGGGTATATGCTGATAAGG - Intergenic
1154485998 18:14871560-14871582 CTCAGGGGCAGATGCTGAGATGG + Intergenic
1156000029 18:32374411-32374433 CATAGGGGCACATGCTGACAAGG - Intronic
1158020206 18:52832783-52832805 CCAAGTGGCACATGTTCATATGG + Intronic
930130916 2:47849609-47849631 CAGTGTGTCACATGCTGATAAGG + Intronic
930386110 2:50697275-50697297 CTCATTGTCACAAGCTGATAAGG + Intronic
932208637 2:69907941-69907963 CTAAGAGGCTCATCCTCATAGGG + Intronic
938634927 2:133213236-133213258 CCAAATGGCACAAGCTGAAAAGG + Intronic
939093960 2:137811176-137811198 CAAAGTGTCAGATGCTGTTACGG + Intergenic
940320647 2:152372861-152372883 CTGAGAGGCACATACTGATTTGG + Intronic
944460338 2:199942387-199942409 CTAAGAAGCAGATGCTGAGATGG - Intronic
947182989 2:227428613-227428635 CTAATTGGTAAATGGTGATAAGG + Intergenic
948079949 2:235197927-235197949 CTAAGGGGCAGACGCTGAGATGG + Intergenic
1171169064 20:22999387-22999409 CTAAGTGGCATATGGTGTTGAGG + Intergenic
1173120069 20:40280745-40280767 CTAAGTGCCAATTGCTGTTAAGG + Intergenic
1173120091 20:40281019-40281041 CTAAGTGCCAATTGCTGTTAAGG + Intergenic
1173177711 20:40777216-40777238 CTAAGTGGCAGAAGCTGATGTGG + Intergenic
1173309398 20:41883577-41883599 CTAAGTAGCAAATGTAGATAGGG - Intergenic
1174605440 20:51757992-51758014 ATTAGTGGCCCATGCTGAAATGG - Intronic
1176795306 21:13367818-13367840 CTCAGGGGCAGATGCTGAGATGG - Intergenic
1178592433 21:33922651-33922673 CTATGTTGCCCATGCTGATCTGG - Intergenic
1182224715 22:28787694-28787716 CTATGTGGCAGGGGCTGATAGGG + Exonic
949295629 3:2519222-2519244 CAAAGTGGCATATTCTGATAAGG + Intronic
949596417 3:5552657-5552679 ATCAGTGGCACATGCTAATCTGG + Intergenic
950841196 3:15969887-15969909 CAAGGTGGCACATGGTGATGGGG + Intergenic
951195958 3:19823509-19823531 CTCAGTGGCACAGGCTGCTGAGG + Intergenic
952752844 3:36839438-36839460 CTAAGTGGCACATGCTGATAAGG + Intronic
956029953 3:65026705-65026727 CCAACTGGCAAATGCTGATATGG + Intergenic
957287495 3:78235629-78235651 CAAAGTGGCACATTTTGAGATGG - Intergenic
958026275 3:88053128-88053150 CTAAGAGGCATATGCTGCTTTGG - Exonic
958047890 3:88307243-88307265 CTAATTGGCACATGCAAATGGGG - Intergenic
958535996 3:95404194-95404216 CTAAGTTGTACAATCTGATAGGG + Intergenic
966943386 3:184760680-184760702 CTCAGTGACACATTCTGCTAAGG - Intergenic
970303464 4:14705738-14705760 CTTAGTGGCAAATGCTAAAAAGG - Intergenic
970813302 4:20122857-20122879 GAAAGTGATACATGCTGATAGGG - Intergenic
975642920 4:76518314-76518336 TTAGGTGCCAGATGCTGATATGG - Intronic
976180000 4:82389962-82389984 TTAATTGTCACTTGCTGATAAGG - Intergenic
981452878 4:144919678-144919700 TTAAGTGGATCATGCTGATATGG + Intergenic
990787895 5:59443452-59443474 CTAAATGGAACATGCTGTTCAGG - Intronic
992213576 5:74504527-74504549 TTAAGTTGCACATGCAGACAGGG - Intergenic
993530399 5:89017550-89017572 CTAAGTGGCACAGGCTGTTTGGG - Intergenic
994871285 5:105352271-105352293 ATAAGTGGCAAATAGTGATATGG - Intergenic
995007083 5:107212580-107212602 CTTGGTGGCACATTATGATAAGG - Intergenic
998863953 5:146475805-146475827 CTAAGTGACCAATGGTGATAAGG - Intronic
1005805471 6:29470624-29470646 CTGTGTGGCACATCCTGAGAAGG - Intergenic
1008261143 6:49367596-49367618 CAATGTGTCACATGGTGATATGG - Intergenic
1015591590 6:134827878-134827900 CTAAGAGGCACTTTCTGATTTGG - Intergenic
1016935147 6:149444100-149444122 CTGAGTGGCACTAGCTGATGAGG - Intergenic
1021864873 7:24945592-24945614 GAAAGTGGCACACTCTGATACGG + Intronic
1025156975 7:56615768-56615790 CTAAGGCCCACATGCTCATATGG + Intergenic
1031398462 7:121302362-121302384 CTCACTGGCAAATGCTGAGATGG + Intergenic
1032492720 7:132335908-132335930 CCAAATGGCACATGCTGGTTGGG - Intronic
1034701486 7:153099903-153099925 CTGAGAAGCACATGCTGAGATGG - Intergenic
1035943765 8:3935297-3935319 ATAAGTGTTTCATGCTGATATGG - Intronic
1036371929 8:8169586-8169608 AAAAGTGGGACATGCTGCTAAGG - Intergenic
1036878975 8:12496057-12496079 AAAAGTGGGACATGCTGCTAAGG + Intergenic
1037409233 8:18577573-18577595 ATAAGTGGCACATAGTTATAAGG - Intronic
1041644544 8:60238180-60238202 CTCAGTGACAAATGATGATAAGG - Intronic
1041897974 8:62948036-62948058 CTAAGCGGCAGTTGCTCATATGG - Intronic
1043415385 8:80043114-80043136 CTAAGTGGGACAAGCTTATGAGG + Intronic
1046976531 8:120284549-120284571 CTAAGTCACACATTCGGATAAGG + Intronic
1048067475 8:130984828-130984850 ATATGTGGGACATGCTGATGAGG + Intronic
1048267281 8:132998717-132998739 CTAAGCTGCACTTGCTGATATGG - Intronic
1048299332 8:133239719-133239741 GCAAGTGGCACATGCTGATGGGG + Intronic
1048342087 8:133548034-133548056 CTATTTGGCACCTGCTGATGGGG + Intronic
1052217260 9:25982483-25982505 CTAAGTGGCAGATGATAATGTGG - Intergenic
1052994938 9:34546970-34546992 CTCAGTGACACATGCTGTTGTGG + Intergenic
1055898175 9:81203913-81203935 CTAAATGATACCTGCTGATATGG - Intergenic
1058376629 9:104329424-104329446 CTAAGCGCCACGTGCTGCTAGGG + Intergenic
1059380682 9:113921043-113921065 CTAAGAGACACATGCTGAGCTGG - Intronic
1061500193 9:130997542-130997564 CTGAGTGGCACCTTCTGGTAGGG - Intergenic
1061931007 9:133833166-133833188 CGTGGTGCCACATGCTGATATGG + Intronic
1186125578 X:6410221-6410243 CTATGAGGCAATTGCTGATAAGG + Intergenic
1187354731 X:18557160-18557182 CGATGTGGAACCTGCTGATACGG - Intronic
1190485153 X:50916503-50916525 CTAATTGGAACATACTTATACGG - Exonic
1198299146 X:135317578-135317600 CCAAGTGGTTCATGCTGGTACGG + Intronic
1199031661 X:143007285-143007307 CAAAATGGTACATGCTGATCAGG + Intergenic