ID: 952753226

View in Genome Browser
Species Human (GRCh38)
Location 3:36842621-36842643
Sequence CGCCAAGCACCAGTGCTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952753226_952753229 9 Left 952753226 3:36842621-36842643 CCTTCCAGCACTGGTGCTTGGCG 0: 1
1: 0
2: 0
3: 15
4: 184
Right 952753229 3:36842653-36842675 CCCTGTGCAATCCACTCCGCAGG 0: 1
1: 0
2: 1
3: 10
4: 86
952753226_952753231 17 Left 952753226 3:36842621-36842643 CCTTCCAGCACTGGTGCTTGGCG 0: 1
1: 0
2: 0
3: 15
4: 184
Right 952753231 3:36842661-36842683 AATCCACTCCGCAGGAGTTGAGG 0: 1
1: 0
2: 0
3: 3
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952753226 Original CRISPR CGCCAAGCACCAGTGCTGGA AGG (reversed) Exonic
901266500 1:7914390-7914412 CACCAAGCACCATGGATGGACGG - Intergenic
902655757 1:17866885-17866907 CCTCAAGCATCAGTGCAGGAAGG - Intergenic
903736844 1:25535323-25535345 CCCCAAGAACCACTGATGGATGG + Intergenic
905136291 1:35803034-35803056 CGCCAGCTACCAGTGCTGCATGG - Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908411076 1:63866124-63866146 CCCCCAGCACCAGTGCTGTTTGG + Intronic
915811942 1:158922409-158922431 CGCAAAGCAACAGTGTTGGCAGG + Intergenic
916022102 1:160801968-160801990 CGCCGCGCAGCAGAGCTGGAAGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1064479779 10:15727738-15727760 CGCCAAGTAGCATTACTGGAAGG + Intergenic
1065725740 10:28666309-28666331 GGCCGAGCACCAGGGCTGGCGGG - Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068883209 10:62072149-62072171 CCCGAAGCATCAGTGCTGGTTGG - Intronic
1069633743 10:69913127-69913149 TGCCAAGAACCAATGCAGGAAGG - Intronic
1070151562 10:73808370-73808392 CGCCATGCTCCAGTTGTGGAAGG - Exonic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071800784 10:89057289-89057311 GGCCAAATACCAGTGCTGCAGGG - Intergenic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1080481158 11:32651554-32651576 AGCCAAGAACCAGTCCTGGGAGG + Intronic
1083723084 11:64613069-64613091 CCACAAGCACCAGTACTGCAAGG + Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085049000 11:73370177-73370199 CGCCAAGCAGCAGTCCTGTTCGG - Intergenic
1085532132 11:77198172-77198194 CACCGAGCACCAGGGCCGGAGGG + Intronic
1094318363 12:29156877-29156899 AGCCAAGCACCAGGTCTCGAAGG - Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096786286 12:54018878-54018900 CGCCAAGTCCCAGTGGGGGAGGG + Intronic
1101555299 12:105803059-105803081 CGGCAAGTAACAGTGGTGGATGG + Intergenic
1103575108 12:121871697-121871719 CACCAGGCACCAGTGATGGCTGG + Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104188696 12:126457572-126457594 GCCCAGGCACCAGTGCTGGAGGG - Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1108579931 13:51819459-51819481 AGCCAAGAACCAGTCCTGGGAGG - Intergenic
1109198513 13:59405891-59405913 CCCAAAGCAGCAGTGTTGGAAGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1113513303 13:110872580-110872602 CGCCCAGTACCTGTGCTGGAAGG - Intergenic
1114083174 14:19218972-19218994 TGTCAGGGACCAGTGCTGGAGGG + Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1116861669 14:50000639-50000661 TGCCAGGCAGCCGTGCTGGAGGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119731991 14:76956858-76956880 CGCCACACACCCCTGCTGGAGGG - Intergenic
1120422245 14:84302894-84302916 TGCCCAGCACCAGTGCAGGAGGG - Intergenic
1121352424 14:93184493-93184515 CGCCAGGCACCAGGGCTGGGAGG - Intronic
1122114673 14:99521807-99521829 CCCCAAGCTCCAGGGCTGGCCGG + Intronic
1122277961 14:100604942-100604964 CTCCAAGCACGAGGGCTGCAGGG - Intergenic
1202894798 14_GL000194v1_random:744-766 TGGCAGGCACCAGTGCTGGAGGG + Intergenic
1127905420 15:63372653-63372675 GGCCCAGCATAAGTGCTGGAGGG - Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131144919 15:90004398-90004420 CGCCAAGCATCAGCACTGGTGGG - Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1133985966 16:10668463-10668485 CTGCAGGCTCCAGTGCTGGAAGG + Intronic
1137496095 16:48970493-48970515 AGCCAATCACCAGTGCTGGCTGG - Intergenic
1138678726 16:58670237-58670259 TCCCAAGAAGCAGTGCTGGATGG + Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1144161972 17:12568748-12568770 GGCCAACCAGGAGTGCTGGAGGG + Intergenic
1144669952 17:17127213-17127235 AGCCCAGCACCAGCCCTGGAAGG - Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1151220737 17:72610713-72610735 AGACAATCTCCAGTGCTGGAGGG - Intergenic
1152128170 17:78459881-78459903 CCCCAAGGACAAGAGCTGGAAGG - Exonic
1152318993 17:79597491-79597513 GGCCCAGCACCAGCGCTGGGGGG + Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154499874 18:14990653-14990675 TGGCAGGGACCAGTGCTGGAGGG + Intergenic
1155390017 18:25325475-25325497 CCCCCAGCACCACTGCAGGAAGG + Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1163729454 19:18940907-18940929 CCCCAAGTTCCAGGGCTGGAGGG - Intronic
1165469244 19:35994030-35994052 CCCCAAGCTCCGGTGCTGGTGGG + Intergenic
1165813102 19:38624202-38624224 CCCCCGGCCCCAGTGCTGGAAGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
928408068 2:31030317-31030339 GGCCGAGCACCAGGGCTGGATGG + Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932594231 2:73084162-73084184 CTCCAAGCACCAGGCCTGGCAGG + Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
938499085 2:131821008-131821030 TGGCAGGCACCAGCGCTGGAGGG + Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939958651 2:148547322-148547344 CGCCAGGCCGGAGTGCTGGATGG - Intergenic
941885781 2:170525713-170525735 CTCCAAGCCCCAGAGCTGCAAGG - Intronic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
948093703 2:235316604-235316626 AGCCAAGAACCACTGCTGTAGGG + Intergenic
949006632 2:241653069-241653091 GCCCAGGCACCTGTGCTGGAAGG + Intronic
1168815987 20:737431-737453 TGCCAGGCACAAGGGCTGGAGGG + Intergenic
1169421591 20:5465101-5465123 CGCCCTCCACCAGTGCTGGGCGG + Intergenic
1170885125 20:20334058-20334080 CTCCCAGCACCAGTGCTGCCAGG + Intronic
1171423888 20:25037550-25037572 CTCCAAGCACCGGTGCTGATGGG + Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1174000204 20:47369082-47369104 AGCCAAGCACCTGTGCAGAATGG - Intergenic
1174810725 20:53643325-53643347 CGTCTAACACCAGGGCTGGAAGG + Intergenic
1175821110 20:61909347-61909369 AGCCAGACACAAGTGCTGGAAGG + Intronic
1176168800 20:63687973-63687995 CGACAAGCACCAGATCTGGGTGG + Exonic
1176614497 21:9016731-9016753 TGGCAGGCACCAGTGCTGGAGGG + Intergenic
1176710706 21:10147140-10147162 TGGCAGGCACCAGCGCTGGAGGG - Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1179626375 21:42651895-42651917 CGTCCAGCACCAGTGCAGGCTGG - Intergenic
1180294799 22:10874295-10874317 TGTCAGGGACCAGTGCTGGAGGG - Intergenic
1180497605 22:15903709-15903731 TGTCAGGGACCAGTGCTGGAGGG - Intergenic
1183037337 22:35150235-35150257 CACCAAGGACTAGGGCTGGAAGG + Intergenic
1184847805 22:47099910-47099932 TGTCAAACACCAGGGCTGGAAGG - Intronic
951260763 3:20504812-20504834 CTCCAAGAACCACTGCAGGAAGG - Intergenic
952753226 3:36842621-36842643 CGCCAAGCACCAGTGCTGGAAGG - Exonic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
954991179 3:54841913-54841935 TGGCAAGCCCAAGTGCTGGAAGG + Intronic
957296912 3:78344277-78344299 CGGCAAACCCCAGTGGTGGATGG + Intergenic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
959565921 3:107833253-107833275 CGCTCAGCTCCAGAGCTGGATGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960087077 3:113603008-113603030 AGTCAAGCTCCAGTCCTGGAAGG + Exonic
961727491 3:128942318-128942340 CGCCACTCACCAGTGCTAGGAGG - Intronic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
963936084 3:151054981-151055003 CTACCAGCACCAGTGCTGAAAGG - Intergenic
964666292 3:159177581-159177603 TGCTAAGGACCAGAGCTGGAGGG + Intronic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
978761195 4:112357636-112357658 CGACAAGCACCAGATCTGGGTGG + Intronic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
982950417 4:161687841-161687863 CACAATGCAACAGTGCTGGAAGG + Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
985570558 5:642552-642574 TGCCGAGCACCAGTGCTGCCAGG + Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
994217695 5:97158103-97158125 CACCAAGGACCAATACTGGAGGG - Intronic
998003272 5:138640870-138640892 CACAAAGAACTAGTGCTGGAAGG + Intronic
998961279 5:147489320-147489342 AGCTAAGCATCAGTGCTGAATGG - Intronic
1000623758 5:163515129-163515151 CACGAAGCAACAGTGCTGGGAGG - Intronic
1001529666 5:172453491-172453513 CCCCAGGCACCCCTGCTGGAGGG + Intronic
1002283213 5:178145450-178145472 CGCCAGGCTGGAGTGCTGGAGGG - Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1006744688 6:36333170-36333192 CTCCAAGCACCAGTATGGGAAGG + Intronic
1007437955 6:41830853-41830875 CACGAAGCACCAGTGCTGACTGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1016883200 6:148931866-148931888 CGCCAAGCACAAGTGCAGTAGGG + Intronic
1017609353 6:156168048-156168070 CCCCAAGCACCCAGGCTGGAGGG + Intergenic
1018987602 6:168649470-168649492 AGCCAGGCACCAGCCCTGGAGGG - Intronic
1019732130 7:2634232-2634254 CGAAAAGCACCAGTATTGGAAGG - Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022112618 7:27240632-27240654 CTCAAAGGCCCAGTGCTGGAGGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1027673366 7:81129562-81129584 GGCAAAGCACCAGTTCTGAAGGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029222733 7:99003183-99003205 AGACGAGCGCCAGTGCTGGAAGG - Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032454818 7:132065362-132065384 CCCTCAGCACCAGTGCTGTAGGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034282236 7:149862408-149862430 GGTCAGGTACCAGTGCTGGATGG - Exonic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035132317 7:156667133-156667155 CTCCAAGCAGCAGGACTGGAAGG + Intronic
1035358256 7:158292618-158292640 CGCCACACACCTGGGCTGGATGG + Intronic
1037605888 8:20436776-20436798 CGCCAAGCACCAGTTTTCCAAGG + Intergenic
1037928733 8:22865132-22865154 GGGGAAGAACCAGTGCTGGACGG + Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040891041 8:52316339-52316361 CACCCAGCACCTGTGCTGGTAGG + Intronic
1042175239 8:66032199-66032221 AGCACAGCACCAGTGCTGGGAGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047615383 8:126558388-126558410 CAACAAGCACCGGAGCTGGAGGG + Exonic
1049767757 8:144362829-144362851 CCCCAAGCACCGGTGCTGATGGG - Intergenic
1050561018 9:6834565-6834587 CCCCAAGCACCAGGGCATGATGG + Intronic
1053647690 9:40132836-40132858 TGGCAGGCACCAGCGCTGGAGGG - Intergenic
1053758041 9:41331007-41331029 TGGCAGGCACCAGCGCTGGAGGG + Intergenic
1054536889 9:66243334-66243356 TGGCAGGCACCAGCGCTGGAGGG + Intergenic
1057214465 9:93220339-93220361 TGCCCAACACCAGTGCAGGACGG + Intronic
1060815099 9:126631028-126631050 CGACTAGAACCAGAGCTGGAGGG - Intronic
1061880310 9:133565663-133565685 CTCCAAGCCCCAGCGCTGGATGG - Intronic
1202795466 9_KI270719v1_random:116128-116150 TGGCAGGCACCAGCGCTGGAGGG - Intergenic
1190245726 X:48688973-48688995 CGGCAGGCACCAGAGCAGGAGGG - Exonic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196326095 X:114404947-114404969 CCCCAAGCAACAGTGTTGGGAGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1200223254 X:154402623-154402645 CCCCCAGCCCCAGGGCTGGATGG + Exonic