ID: 952754088

View in Genome Browser
Species Human (GRCh38)
Location 3:36850954-36850976
Sequence CTGGCTGCTGACTGTACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952754088_952754095 20 Left 952754088 3:36850954-36850976 CCCACAGTACAGTCAGCAGCCAG 0: 1
1: 0
2: 0
3: 10
4: 178
Right 952754095 3:36850997-36851019 TAGTGGGAAAGAGAAAACAGTGG 0: 1
1: 0
2: 1
3: 62
4: 601
952754088_952754092 4 Left 952754088 3:36850954-36850976 CCCACAGTACAGTCAGCAGCCAG 0: 1
1: 0
2: 0
3: 10
4: 178
Right 952754092 3:36850981-36851003 AGTCTCCACCAAAAGATAGTGGG 0: 1
1: 0
2: 2
3: 12
4: 158
952754088_952754091 3 Left 952754088 3:36850954-36850976 CCCACAGTACAGTCAGCAGCCAG 0: 1
1: 0
2: 0
3: 10
4: 178
Right 952754091 3:36850980-36851002 GAGTCTCCACCAAAAGATAGTGG 0: 1
1: 0
2: 0
3: 5
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952754088 Original CRISPR CTGGCTGCTGACTGTACTGT GGG (reversed) Intronic
900278916 1:1852768-1852790 CTGGCTCCTGAGTGTAGGGTAGG - Intronic
900476363 1:2878204-2878226 CTGGCTGCTGGCTGTTGTGGGGG + Intergenic
900744827 1:4353930-4353952 CTGGCTGCTGAATGGCCAGTAGG + Intergenic
900881572 1:5385446-5385468 CAGGCTGGTGAATGGACTGTGGG + Intergenic
905224072 1:36467838-36467860 CAGGGTGAGGACTGTACTGTTGG + Exonic
906322975 1:44828068-44828090 CTGGCTGCTGGCTTCACAGTGGG + Exonic
908494375 1:64679774-64679796 CTGGCTGCTGCCTCCCCTGTGGG - Intronic
909381821 1:75007043-75007065 CTGGCTGCTTACTAGATTGTAGG - Intergenic
909514193 1:76488877-76488899 CTGGCTGTTGACTGTCCAGCAGG + Intronic
909840216 1:80311621-80311643 CTGGCTGCTGAGTGGAGTGAGGG - Intergenic
911131282 1:94390790-94390812 CTGGTTTCTGAATGTGCTGTCGG - Intergenic
911840867 1:102680180-102680202 CTTGCTGATGACTGTAATGCAGG + Intergenic
917662709 1:177193206-177193228 GTGGCTTCTGACTGTAGGGTAGG - Intronic
920751570 1:208682904-208682926 CTGGCTGCTGACAGGATTATAGG + Intergenic
921050677 1:211509083-211509105 CTGGCTGCTGGCTCTCCTGTAGG + Intergenic
922056385 1:222046042-222046064 TTGGCTGCTGAGTGCAATGTGGG + Intergenic
922584292 1:226722162-226722184 CTGGCCTCTGACTGTAGTTTGGG - Intronic
1063823496 10:9865766-9865788 ATGGAGGCTGACTGTATTGTTGG - Intergenic
1066409142 10:35149172-35149194 CTGGCTGCTCCCTCTTCTGTAGG - Intronic
1071870009 10:89783450-89783472 CTGCCTTCTGTCTTTACTGTGGG - Intergenic
1072399846 10:95086765-95086787 CTGGCTCCTGACAGGACTTTTGG - Intergenic
1073217320 10:101843648-101843670 CTGGCGGCCTACTGTGCTGTCGG + Intronic
1075343088 10:121662739-121662761 CAGGCTGCTGACAGCACTGCAGG + Intergenic
1075534655 10:123260132-123260154 CTGGCTGCTCACAGCAGTGTGGG - Intergenic
1076309818 10:129497323-129497345 CTTGCTGCTGACTGCAGTGCCGG - Intronic
1083581283 11:63827074-63827096 CTGGATTCTGACAGAACTGTGGG - Exonic
1083801590 11:65049180-65049202 CTGGCTGATTACTGTATTTTTGG + Intronic
1085601785 11:77861949-77861971 CTGTCACCTGACTGTACTGAAGG - Intronic
1085910218 11:80815721-80815743 CTGTCTGCTGAATGTAAGGTGGG - Intergenic
1088696937 11:112374915-112374937 CTGATTGCTGAGTGAACTGTCGG + Intergenic
1088815996 11:113421280-113421302 CCGGCAGCAGACTGCACTGTAGG + Intronic
1088934076 11:114380930-114380952 CAGGCTGCTGCTTGCACTGTAGG + Intergenic
1089239417 11:117063420-117063442 CTGGCAGCTGACTTTACATTGGG - Intronic
1089397870 11:118147629-118147651 CTGGCTGCAGACTGGAGAGTGGG - Intronic
1090373642 11:126274195-126274217 CTGGCTTGTGAGTGTTCTGTTGG + Intronic
1091658397 12:2362747-2362769 GTGGCTGCAGACTGTAATGAGGG + Intronic
1091970156 12:4780017-4780039 CTGGCTGCCCACTGATCTGTGGG + Intronic
1093410936 12:18865813-18865835 TTGCCTGCTGATTGTACTGCAGG + Intergenic
1093482969 12:19624229-19624251 CTGGGTACTGACTGTGCTGCAGG - Intronic
1096401769 12:51313291-51313313 CTTGCTGCTGACTGTCATTTTGG - Intronic
1096977217 12:55706431-55706453 CTGTCTTCTGCCTCTACTGTCGG - Intronic
1100218304 12:92476869-92476891 CTGGCTGCTGAGTGCCCTTTGGG + Intergenic
1103926966 12:124428599-124428621 CTGGCTGCAGAGTGCTCTGTTGG - Intronic
1105442344 13:20425873-20425895 CTGCCTGCCGACTGTACAGTGGG - Intronic
1106480749 13:30135370-30135392 CTGGCTGCTGGCTGTAGAATGGG + Intergenic
1106762188 13:32878199-32878221 CTGGCTGCTGATGGTTCTGACGG + Intergenic
1119653318 14:76398919-76398941 CTGTCTGCTGAGGGGACTGTAGG + Intronic
1120596725 14:86448839-86448861 CTGGCTGCTGAGTTTCCTGCTGG + Intergenic
1120733632 14:88029510-88029532 CTGGTTGCTGAGAGAACTGTTGG + Intergenic
1125539213 15:40459994-40460016 CTGGCTGCTAACTGGAAGGTAGG + Intronic
1125584326 15:40809579-40809601 CTGGCTCCTGACTGCCCTCTTGG + Intronic
1125699468 15:41669090-41669112 CTTCCAGCTGATTGTACTGTGGG + Exonic
1133144079 16:3770682-3770704 TGGGCTGCTGCCTGGACTGTAGG + Exonic
1134572232 16:15300900-15300922 CAGGCTGCTGATTGTTCTGAGGG + Intergenic
1134572296 16:15301549-15301571 CAGGCTGCTGATTGTTCTGAGGG + Intergenic
1134730149 16:16455148-16455170 CAGGCTGCTGATTGTTCTGAGGG - Intergenic
1134937282 16:18256751-18256773 CAGGCTGCTGATTGTTCTGAGGG + Intergenic
1134937348 16:18257401-18257423 CAGGCTGCTGATTGTTCTGAGGG + Intergenic
1136277519 16:29187642-29187664 CTGGCTGCTGAGAGTTCTGGAGG + Intergenic
1137826196 16:51497924-51497946 CAGTCTGCTCTCTGTACTGTGGG + Intergenic
1139506561 16:67400914-67400936 GTGGCTGCCGAGTGTGCTGTGGG - Intronic
1139967789 16:70755243-70755265 CTGGCTGCTCACTGACCTGGTGG - Intronic
1140475046 16:75235582-75235604 CTGGCTGCTGCGTGTGCTGCCGG + Exonic
1140665941 16:77227728-77227750 GTGGCTGCTGATTCTACTGCTGG - Intergenic
1142436372 16:90060940-90060962 ATGGCAGCTGAGTGAACTGTAGG - Intronic
1143018681 17:3905024-3905046 GTGGCTGCTGCGTGTCCTGTGGG - Intronic
1143631405 17:8142448-8142470 CTGGCTGCTGCCTGTGAAGTGGG + Exonic
1143765437 17:9134695-9134717 CTGGCTGCTCATTGCCCTGTGGG + Intronic
1144511994 17:15885316-15885338 GTGGCTGCTGGCTGTTCTTTGGG + Intergenic
1144782964 17:17817074-17817096 CTGGCTGCTCAATGGGCTGTTGG - Exonic
1144801919 17:17935060-17935082 CTGGCTGCTTTCTATGCTGTGGG - Intronic
1144862208 17:18312191-18312213 CTGTCTCTTGTCTGTACTGTGGG - Intronic
1145970076 17:28951184-28951206 CCGGCTGCTGGCTGCACAGTGGG + Exonic
1147607823 17:41784410-41784432 CTGGCCACTGACTGGACTGGGGG - Intronic
1149063805 17:52456587-52456609 CTGACTTCAAACTGTACTGTGGG + Intergenic
1150637125 17:66921200-66921222 CTGGCTGCTGGCTGTGATGCTGG - Intergenic
1151871470 17:76839881-76839903 CTGGCTGCTGGCTGCGGTGTTGG + Intergenic
1152206180 17:78975907-78975929 CTGGGAGCTGGCTGTGCTGTGGG + Intronic
1154011843 18:10581008-10581030 CTGTCTGCTGCCTAGACTGTGGG + Intergenic
1154933343 18:21024503-21024525 CAGGGTGCTGACTGTAGTGGTGG - Intronic
1156678851 18:39565406-39565428 GTTGCTGCTGACTTCACTGTTGG - Intergenic
1157131787 18:45014129-45014151 CTGGCTGCTGATTGTACAGCAGG - Intronic
1157615359 18:48984102-48984124 CAGGCTGCTCACTGGCCTGTTGG - Intergenic
1160350467 18:78174142-78174164 GTGGCTGCTCATTGTAATGTTGG - Intergenic
1162396304 19:10419710-10419732 CTGTCGTCTGACTGTAGTGTCGG - Intronic
1162479819 19:10921657-10921679 CTGGCTGTTGACTGCATAGTGGG - Exonic
1162502592 19:11062501-11062523 CTGCCTGCTCCCTGCACTGTAGG - Intronic
1163439362 19:17313865-17313887 CTGGCTGCTGGATACACTGTCGG - Intronic
1164784715 19:30920759-30920781 CTTTCTGCAGACTGTCCTGTGGG + Intergenic
925451634 2:3974031-3974053 CTGTCTGCTGACTGGACTCTGGG + Intergenic
925869029 2:8253366-8253388 CCGGCTGCTGCCAGTGCTGTGGG - Intergenic
926423867 2:12723889-12723911 CTGGCTGCTGAGTGTTCTGCGGG - Intronic
928848273 2:35707603-35707625 CTGCATGCTGACTGAACTGTGGG - Intergenic
929645269 2:43619796-43619818 GTGGCTCCTGCCTGTAATGTCGG - Intergenic
935028932 2:99303616-99303638 CTGGCTGCTGATTGCATTGGAGG + Intronic
935565811 2:104606036-104606058 ATGGCTGCTGACTGATCAGTTGG - Intergenic
937212130 2:120281308-120281330 CTGGCTGGAGACTGTCCTGCCGG - Intronic
937664391 2:124468312-124468334 CAGGCTGAAGACTGCACTGTTGG - Intronic
939457995 2:142462936-142462958 CTGGGTCCTGTCTGTAATGTGGG + Intergenic
941801490 2:169664677-169664699 CTGGTTGCTGACTCTGCTTTGGG - Intronic
942604587 2:177676981-177677003 ATGGATGCTGACAGTACTGGAGG + Intronic
946265593 2:218538643-218538665 GTGGCTGCTGAATGTCCAGTTGG + Intronic
947828708 2:233124284-233124306 CTGGCTCCTGCCTGTTCTGGGGG + Intronic
1169736736 20:8845901-8845923 CTGGCTGCCAAGTGTCCTGTAGG + Intronic
1169776867 20:9264811-9264833 CTGGGTGCAGCCTGGACTGTGGG + Intronic
1175065471 20:56282731-56282753 CTGGCTGCTGAGTTTAATATGGG - Intergenic
1176703158 21:10083265-10083287 CTGGTTGGTGACTGTAGTGGGGG - Intergenic
1178641610 21:34349172-34349194 ATGGCTGCTGACGTTACTGATGG + Intergenic
1181485073 22:23225436-23225458 CTGGCTGGAGACTGGACTGCGGG + Intronic
1184754343 22:46507832-46507854 CTGACTGCCCACTGTACTCTGGG - Intronic
950444384 3:13027798-13027820 CTGGCTGATGGCTGCTCTGTAGG + Intronic
951035795 3:17930601-17930623 CTGGCTGCTGACTGTTGGGTGGG + Intronic
952606231 3:35150025-35150047 ATTGCTAATGACTGTACTGTGGG - Intergenic
952754088 3:36850954-36850976 CTGGCTGCTGACTGTACTGTGGG - Intronic
953367386 3:42357478-42357500 ATGGCTGCTGACTGATCAGTTGG - Intergenic
954407466 3:50353444-50353466 AGGGCTGCTGGCTGTGCTGTGGG + Exonic
954557527 3:51530057-51530079 GTGGCTACTGACTGAGCTGTTGG + Intergenic
954980387 3:54740425-54740447 CTGGCTGAAGACCCTACTGTAGG - Intronic
956466801 3:69527688-69527710 CAGGTTGGTCACTGTACTGTAGG - Intronic
961111265 3:124285350-124285372 GTGGCTACTGACTGTCCTGTTGG - Intronic
962299156 3:134222322-134222344 TGGGCTGCTGTCTGTACTGAAGG - Intronic
963938561 3:151078882-151078904 CTGGCTTCAGACTTTCCTGTTGG - Intergenic
966146974 3:176823419-176823441 CTGACAGCTGACTGGACTGCTGG - Intergenic
966882366 3:184357652-184357674 CTGGCTGCCGCCTGTGCCGTGGG - Exonic
967410902 3:189165698-189165720 CAGGCTGCTCACTGCACTGGGGG + Intronic
969546751 4:7835016-7835038 GTGGCTCCTGAATGGACTGTGGG + Intronic
970238179 4:13980130-13980152 CTGCCTGTTGACAGTAATGTGGG - Intergenic
973902201 4:55487352-55487374 CTGACTGTTAACTTTACTGTAGG + Intronic
974565295 4:63573120-63573142 CAGACTGAAGACTGTACTGTGGG + Intergenic
975325649 4:73055874-73055896 CTGGTTTCTGACTGTCCTATTGG - Intergenic
976014999 4:80542187-80542209 CTGACTGAGGGCTGTACTGTTGG + Intronic
980375361 4:131939633-131939655 CTGGTTGGTGACTGTAATGGGGG - Intergenic
984297413 4:177870116-177870138 ATGGCTGCAGTCTGTAATGTGGG - Intronic
986715698 5:10522137-10522159 CTGGCTGCTTCCTGTACCTTGGG - Intergenic
997581202 5:135018565-135018587 GTGGCTGCAGCCTGTGCTGTGGG + Intergenic
997591538 5:135076172-135076194 CTGCCTGCAGAATGTACTGCGGG + Intronic
998081642 5:139279938-139279960 CTGGCTGCTGACTACCCTATTGG + Intronic
1000282876 5:159797420-159797442 CTGCATGCTGACTGCACAGTAGG - Intergenic
1001512865 5:172336053-172336075 CTGTCTGCTGACTTCACTGAAGG - Exonic
1001762648 5:174221049-174221071 ATGGCTGCTGATTCTAATGTGGG + Intronic
1002439329 5:179256211-179256233 CTGGCGGCTTACTGTTCTGTGGG - Intronic
1002817857 6:695516-695538 CTGGCTGCTGTTTATACTTTGGG + Intergenic
1004054877 6:12125522-12125544 CTGGCTGTTGACTTTGCTCTTGG - Exonic
1005939164 6:30547830-30547852 CTGGGTACTTACTGTACTGCAGG - Intronic
1007227340 6:40324493-40324515 CTGTCTGCTGCCTGTGCTGCTGG + Intergenic
1011413026 6:87085572-87085594 TAGACTGCTGATTGTACTGTAGG + Exonic
1012254826 6:97019576-97019598 CTAGCTGCTGAGAGAACTGTGGG - Intronic
1013950874 6:115780478-115780500 CTGGCTACTGTATGTACTGCAGG - Intergenic
1014444787 6:121514620-121514642 CAGGCTGCTGCCTGAACTTTGGG + Intergenic
1021577068 7:22114639-22114661 CTGGCTCCTCACTGTACTCCTGG - Intergenic
1023780040 7:43646967-43646989 CTGGCTGCTGACAGTAATTGTGG + Intronic
1024996908 7:55279194-55279216 CGGGCTGCTGACACCACTGTGGG - Intergenic
1026134131 7:67644385-67644407 CTTGCTGCTGACTGTCCTCCTGG - Intergenic
1028193531 7:87878484-87878506 TTGACTGCTTACTGTAATGTTGG + Intronic
1032591182 7:133193818-133193840 GTGCCTGCTGACTGTTCTGTGGG + Intergenic
1035348901 7:158229116-158229138 CTGAGTGCTGCCTGTACTGAAGG - Intronic
1035474972 7:159136875-159136897 CTGGCTGCTTCCTGTCCTGCTGG - Intronic
1035821418 8:2596355-2596377 CTGTCTGCTCACCGTCCTGTGGG + Intergenic
1039613346 8:38936557-38936579 CTGGCTGCTGAATGTCTTCTTGG - Intronic
1039880385 8:41621899-41621921 CTGGCTGGTGAATGAACTGGGGG + Exonic
1044942354 8:97356263-97356285 ATGGTTGCTGACTTTGCTGTAGG - Intergenic
1047673133 8:127170821-127170843 CAGGCTGCTGACAGCAATGTTGG - Intergenic
1048109698 8:131454242-131454264 CTGCCTGCTGCCTCTCCTGTTGG + Intergenic
1048281988 8:133112474-133112496 GTTGCTGCTGTCTGCACTGTGGG - Intronic
1050552388 9:6758934-6758956 CCGGCTGCTGGCTTTACTGGCGG - Intronic
1051198641 9:14592440-14592462 CTGACTGTATACTGTACTGTTGG - Intergenic
1053640416 9:40070297-40070319 CTGGTTGGTGACTGTAATGGGGG - Intergenic
1053765722 9:41395177-41395199 CTGGTTGGTGACTGTAATGGGGG + Intergenic
1054321110 9:63666292-63666314 CTGGTTGGTGACTGTAATGGGGG - Intergenic
1054544333 9:66306330-66306352 CTGGTTGGTGACTGTAATGGGGG + Intergenic
1056237336 9:84607938-84607960 GTGGCTCATGACTCTACTGTGGG + Intergenic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1057276106 9:93676745-93676767 CTGGCTGCTGGCCGTGCTGGTGG - Exonic
1058893175 9:109378762-109378784 CTGGGTGCTGAGTGTGCAGTAGG + Exonic
1060712420 9:125881381-125881403 CTGGCTGCTGACTCTAGGATAGG + Intronic
1060731184 9:126038030-126038052 CTGGCTGCTGTCTGCAGTCTTGG + Intergenic
1060818800 9:126650083-126650105 CTGGCTGCTGCCTCTGCTGGGGG - Intronic
1061014399 9:127973554-127973576 CTGCCAGCTGGCTGCACTGTTGG - Intronic
1062030610 9:134360276-134360298 CAGGCTGCGGACTGGCCTGTCGG + Intronic
1062033454 9:134372324-134372346 CTGGATGCTGGCTTTGCTGTTGG + Intronic
1062199935 9:135297201-135297223 CAGGCGGCTGCCTGTGCTGTGGG + Intergenic
1062337730 9:136079806-136079828 CCGGCTGCTGCCTGTCCTGGTGG - Intronic
1202788187 9_KI270719v1_random:53372-53394 CTGGTTGGTGACTGTAGTGGGGG - Intergenic
1186413488 X:9363548-9363570 CTGGCTCCTGCCTAGACTGTGGG + Intergenic
1188434501 X:30145572-30145594 CTGGCTGTTGACAGTTCTCTTGG + Intergenic
1188738204 X:33743925-33743947 CTGACTGCAAACTATACTGTAGG - Intergenic
1195941159 X:110169128-110169150 TTGGCGGCTGCCTGTACTCTAGG - Intronic
1197179578 X:123519975-123519997 CTTGCTGCTGACAGTGCTGCTGG - Intergenic
1202147169 Y:21810516-21810538 CTGGCTGCTGGCAGAACTGCAGG + Intergenic