ID: 952754546

View in Genome Browser
Species Human (GRCh38)
Location 3:36855065-36855087
Sequence AGGTTTTTACAGCTGAAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 7, 3: 13, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952754546_952754548 5 Left 952754546 3:36855065-36855087 CCTTACTTCAGCTGTAAAAACCT 0: 1
1: 0
2: 7
3: 13
4: 167
Right 952754548 3:36855093-36855115 GAGCTAGTCTGCAGCTTCAAAGG 0: 1
1: 0
2: 0
3: 12
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952754546 Original CRISPR AGGTTTTTACAGCTGAAGTA AGG (reversed) Intronic
903234770 1:21942685-21942707 AGTCTTCTATAGCTGAAGTAGGG - Intergenic
908508436 1:64829386-64829408 AGTTCTTTATACCTGAAGTAAGG + Intronic
908542142 1:65131782-65131804 AAGTTTTTACACCTAATGTAAGG - Intergenic
908870354 1:68603541-68603563 AGTTCTTTATAGCTCAAGTATGG - Intergenic
911554550 1:99327650-99327672 AGGTTTTTAGAGATGATGTTTGG - Intergenic
920976525 1:210791043-210791065 AGGTTTGGACAGTTGAGGTAGGG - Intronic
922332825 1:224592716-224592738 TAGTTTTGACAGCTGAAGTTGGG + Intronic
922355194 1:224768783-224768805 TTTTTTATACAGCTGAAGTAGGG + Intergenic
922639898 1:227219251-227219273 AGCTTTTGACACCTGAAGCAGGG + Intronic
1063881075 10:10533122-10533144 AGGTGTTTACAGCTATATTATGG - Intergenic
1064871543 10:19943154-19943176 AGGATTCTGGAGCTGAAGTATGG + Intronic
1066567544 10:36735633-36735655 AACTTTTTAGAGCTGAAGTTTGG + Intergenic
1067004604 10:42648881-42648903 AGGTTTTAACACCAGCAGTAGGG - Intergenic
1067776298 10:49167190-49167212 CAGTTTCTACAGCTGAAGGAGGG - Intronic
1069010342 10:63364879-63364901 AGGTTGCTATAGCTGTAGTATGG - Intronic
1070347219 10:75556508-75556530 AGGTTCTTCCAGTTGAAGAATGG + Intronic
1071329727 10:84547553-84547575 AGGTTTTAATATCTGAAGCAAGG - Intergenic
1072171074 10:92862339-92862361 AGGTTTTAACATATGAATTATGG - Intronic
1073032623 10:100539425-100539447 AGCCTTCTACAGCTAAAGTAAGG - Intronic
1073278849 10:102336794-102336816 AGGATATTACAGCTAAAATAGGG - Intronic
1075381527 10:122022783-122022805 AGGTTTTCACAATTGAAGAATGG + Intronic
1079664734 11:23090456-23090478 ATGTAATTACAGCTGAAGTTGGG - Intergenic
1079905261 11:26237271-26237293 AAATTTTTACATCTGAAATAAGG + Intergenic
1081401667 11:42650086-42650108 AGCTTGGTACAGCTGAAGTGTGG + Intergenic
1083262203 11:61529245-61529267 AGGTTTCTACAGGGGAAGTTGGG - Intronic
1085502522 11:77037164-77037186 AGGTTTTTCCAGCTGCGGGAGGG + Intronic
1086011240 11:82105910-82105932 AGGTTTTTAGAGCAGAATAAAGG - Intergenic
1087290302 11:96313838-96313860 AGGGTTTTACAGCAGAAATTTGG + Intronic
1092829561 12:12430507-12430529 AGGTTTTTACTTATGGAGTAGGG + Intronic
1095168554 12:39005118-39005140 AGGTTTTTACACCTGAGATAGGG + Intergenic
1097919616 12:65057368-65057390 AGAATTTTAGAGCTGGAGTAAGG + Intronic
1099518310 12:83626890-83626912 AGGTGTATATAGATGAAGTATGG - Intergenic
1100260352 12:92927731-92927753 ATGTCTTTACTGCTGAACTAAGG + Intronic
1100711359 12:97260464-97260486 AGGATTTATCAGCTGAAATATGG + Intergenic
1101262302 12:103045525-103045547 ACCTTTTTAAAGCTGAAGAATGG - Intergenic
1101469178 12:104979340-104979362 AGGTCTTTACTGCTGCAATAAGG - Intergenic
1102580753 12:113885638-113885660 AGATATTTACTGGTGAAGTAGGG + Intronic
1103977738 12:124714599-124714621 AGGTTTTTACAGGAGAGGGAGGG - Intergenic
1106413920 13:29530128-29530150 AGGTATTTAAAGGTGAAGTGAGG + Intronic
1107146673 13:37067783-37067805 AGGTTTTAAGAGCTGGAGTAGGG - Intergenic
1107621402 13:42234468-42234490 TTGTTTTTACAGCTTAATTAAGG - Intronic
1110916509 13:81028004-81028026 ATGTCTTTATAGCTGAAGTGTGG + Intergenic
1111465949 13:88611030-88611052 ATGTTTTTGCAGCTGGAGCAGGG - Intergenic
1113416935 13:110136130-110136152 AGCCTTTTACAGCTGAACTGTGG + Intergenic
1114937461 14:27559613-27559635 AGGATCTTACAACTAAAGTATGG + Intergenic
1116585482 14:46697723-46697745 AGGTTTTAACAGATGAATTTTGG + Intergenic
1117248720 14:53913776-53913798 ACATTTCTACAGCTAAAGTAAGG + Intergenic
1122412707 14:101534100-101534122 AGCTTATTACAGCTGAGGTGAGG - Intergenic
1126547589 15:49889858-49889880 AGATGTTTTCAGCTGAAGAAAGG + Intronic
1127662571 15:61113949-61113971 ATGTTTTTCCATCTGAAATAGGG + Intronic
1128950613 15:71876757-71876779 AGTTTTCTACAGCTAAAATACGG - Intronic
1129491644 15:75932261-75932283 AGAATTTGACAGCTGAAGTCGGG + Intronic
1131302713 15:91213593-91213615 AAATTTTTACAGATGAATTATGG - Intronic
1131502576 15:92983243-92983265 AGGTTTTTATTGCTGAAGAAAGG - Intronic
1133912603 16:10079455-10079477 AGGTTTTAACATCTGAATTTTGG - Intronic
1137868657 16:51928350-51928372 TGGTTGTTACAGCAGAAGTTTGG + Intergenic
1139021301 16:62753157-62753179 AGCTTTTGACAGCTGAAGGATGG - Intergenic
1140345848 16:74212438-74212460 AGGTTTTTACAGCCCAGGGAAGG + Intergenic
1143907570 17:10221510-10221532 AGATTTTTAATGCTGAAGAATGG - Intergenic
1144027715 17:11293145-11293167 AGGTTTTTCCAGTTGCTGTATGG + Intronic
1145902576 17:28498120-28498142 CGGTTTTTCCAGCTGGAGGAAGG - Intronic
1146015405 17:29229158-29229180 AGGTCTTTGCAGATGAAATAAGG + Intergenic
1151841769 17:76623995-76624017 TGCTTTTTATTGCTGAAGTAAGG + Intergenic
1156825804 18:41429119-41429141 AGTTTTGTACAGCTGAAGCTGGG + Intergenic
1157041767 18:44048030-44048052 ATGTTTTTCAAACTGAAGTATGG - Intergenic
1157193644 18:45601820-45601842 AAGTCTTTTCAGCTGAACTATGG + Intronic
1157733033 18:50021206-50021228 AGGTTTTCACAGCTGTGGCATGG - Intronic
1158201036 18:54940568-54940590 AGGTATATACAGCTGATGTTGGG + Intronic
1159547800 18:69862226-69862248 ACATTTTTACAGTTGTAGTATGG - Exonic
1163301154 19:16447280-16447302 AGGTTTCTACAGCAGAGCTAAGG + Intronic
1163593099 19:18205147-18205169 AGGGTTTGAAAGCTGGAGTAGGG - Intergenic
926698847 2:15789186-15789208 AGGTCTGTACAGCTGAAAAATGG + Intergenic
928805180 2:35141254-35141276 AGTTTTTTACAGATGATGGAAGG - Intergenic
929534916 2:42775430-42775452 ATTTTTTTCCAGCTGAAATACGG + Intronic
930434381 2:51321968-51321990 AGGTTTTTACATCTGTAACATGG - Intergenic
932951231 2:76296086-76296108 AGATTTTTTCAACTGAAGTCAGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
938556754 2:132431312-132431334 AGGATCTTACATCTGAAATAAGG - Intronic
939727396 2:145739708-145739730 AGGTTTTGAGAGCTGAACTGAGG - Intergenic
941117874 2:161492595-161492617 AGGTTTTTGCTGTTGAATTAAGG + Intronic
942271919 2:174284671-174284693 AGGTTTTTATAGTTTAAATAGGG - Intergenic
946854546 2:223940026-223940048 AGCTTTTTACATTTAAAGTAGGG - Intronic
947526552 2:230880102-230880124 ATGTTTTTACAGGTCAAGTTAGG + Intergenic
947526712 2:230881415-230881437 ATGTTTTTACAGGTCAAGTTAGG + Intergenic
1173456286 20:43204511-43204533 TGGTTTTCACATCTGAAATATGG - Intergenic
1177630374 21:23719502-23719524 ATGTTTATAAAGCTGAGGTAAGG - Intergenic
1178945859 21:36947125-36947147 ATGTTTTTACAGCTAAATTCCGG - Intronic
1181303789 22:21902461-21902483 AGGCTTTGAGAACTGAAGTATGG - Intergenic
1182890435 22:33813801-33813823 AGGTATTTAAGGCTGAAGTTGGG - Intronic
1183679416 22:39318916-39318938 AGGTTTTGACCGCTAAAGAAAGG + Intronic
950933761 3:16817754-16817776 AAGTGGTTACATCTGAAGTAGGG - Intronic
951179924 3:19647569-19647591 AGGTTGTTACAGCAGAAGAAGGG - Intergenic
952363959 3:32658489-32658511 ATGTTTTTCCAGCTGAGGTGAGG - Intergenic
952754546 3:36855065-36855087 AGGTTTTTACAGCTGAAGTAAGG - Intronic
955004965 3:54959874-54959896 AGGTTTCTTCAGATGAAGTCTGG + Intronic
955031480 3:55225676-55225698 AGGGTTTTAGAGATGAGGTAAGG + Intergenic
955040134 3:55308377-55308399 AGGTTTTCACAAATGAATTAGGG + Intergenic
955397369 3:58566684-58566706 TGGTTTTTCCAGCTGAAGGAGGG + Exonic
956756342 3:72391517-72391539 TGGGTTTTACAGAAGAAGTATGG - Intronic
957163616 3:76642029-76642051 AGTTTTTAAAAGCTGACGTAGGG + Intronic
957456178 3:80450303-80450325 AGGTTTTTACTTCTAAAATAAGG + Intergenic
958116122 3:89220020-89220042 TGGTTCTCACAGCTGAAGAAAGG + Intronic
959930578 3:111977805-111977827 AGGTATTTAGAGCTGGAGTCCGG + Intergenic
961250405 3:125499611-125499633 AGTATTTTTCAGCTGAAGTTGGG - Intronic
964213457 3:154253511-154253533 AGGGCTTTACAGTTCAAGTAGGG - Intronic
964856377 3:161150398-161150420 AGGTTTTTGCAGCAGTAGAAAGG + Intronic
965034902 3:163425243-163425265 AGGTGTCTACTGCTGAAGTGAGG - Intergenic
967003915 3:185365465-185365487 CGGTTTTGCCATCTGAAGTATGG - Intronic
967479214 3:189955074-189955096 TTGCTTTTACAGCTGAAGGAGGG - Intergenic
970083558 4:12319116-12319138 AGGTTTTTACTCATGAAGAATGG - Intergenic
970383463 4:15531853-15531875 TGGTTTTTAAAACTGAAGCAGGG + Intronic
971103564 4:23497089-23497111 AGGTACTTACAGATGAAGAAGGG + Intergenic
971158120 4:24104802-24104824 AGCCTTTTACAGCTAAAGAAAGG + Intergenic
972073459 4:35054057-35054079 AGGTTTTCGCAGCCAAAGTAGGG + Intergenic
972868990 4:43272705-43272727 AGGTATTAACAGCTGAATAATGG + Intergenic
973088380 4:46098787-46098809 AGGTTTTTATAGCTGATGTTTGG - Intronic
978240605 4:106511434-106511456 AGATTTTTAGAGCTGAATGATGG + Intergenic
978553074 4:109948785-109948807 ATGTCTTTACATCTGAAGGATGG - Intronic
979835695 4:125364710-125364732 AGGTTTTTTCAGCTGGTGCATGG + Intronic
983414148 4:167434603-167434625 AGGCTAGTTCAGCTGAAGTATGG - Intergenic
983537572 4:168874583-168874605 TGGATGTTACAGCTGCAGTAAGG + Intronic
984620945 4:181951087-181951109 AGATTTTTAAAGCTGATCTATGG - Intergenic
986207482 5:5638721-5638743 AGCTTTTTATAGCTGAAATTGGG + Intergenic
988336894 5:29919526-29919548 ATGTCCTTACAGCTGAGGTAGGG - Intergenic
989470812 5:41815842-41815864 GGGTTTTTACAGCTACAGAAAGG + Intronic
989701968 5:44278836-44278858 AGATTTATACAGTTGAAATAAGG - Intergenic
990949673 5:61286243-61286265 AGGTTTTAACATCTGAATTTGGG + Intergenic
994760473 5:103845998-103846020 AGATTATGACAGCTGAATTATGG + Intergenic
998213267 5:140217779-140217801 AGGCTTTTCCAACTGAGGTAAGG + Intronic
999163319 5:149524461-149524483 TGGTTTTTACAGCCAAAGTTTGG - Intronic
1000327355 5:160182412-160182434 CGGTTTTTACATCTGTAGAATGG - Intergenic
1000380769 5:160627322-160627344 AGGATTTTACAGCTCAATGAAGG - Intronic
1006875861 6:37295646-37295668 AGGTTCTTACAGATCAAATAAGG + Intronic
1010573390 6:77505356-77505378 ATGTTCTTACAGCCGAGGTAGGG - Intergenic
1011001765 6:82597712-82597734 AGGTTTTTAAAAATGGAGTAGGG + Intergenic
1011457935 6:87572189-87572211 TAGTTTTCACAGCTGAAATACGG + Intronic
1011950784 6:92960795-92960817 GGGTTGTTCCAGCTGAAGCAAGG + Intergenic
1012080126 6:94747350-94747372 AGGTTTTTATATCTGAAATACGG - Intergenic
1013073325 6:106748888-106748910 AAGTTTTCACAGCTCAAGGATGG - Intergenic
1013352643 6:109319308-109319330 AGGTTTTTCCAGAGGAAGTTAGG + Intergenic
1014948165 6:127520521-127520543 AGGATATTACAGCTCAAGTTTGG - Intronic
1015551774 6:134419453-134419475 AAGTTTTTCCAGGTGAAGTATGG - Intergenic
1015858270 6:137648764-137648786 TGGTTTTTGCAGCTGTGGTATGG + Intergenic
1017020521 6:150136427-150136449 AGGTTTCTACAGATGAATTTTGG + Intergenic
1018363192 6:163093546-163093568 AAGCTTTTACAGCTGGAATATGG + Intronic
1018538265 6:164847607-164847629 AAGTATTCACAGTTGAAGTAAGG - Intergenic
1021112857 7:16715093-16715115 ATGTTTTGACACCTGAAGTTTGG - Intergenic
1022838771 7:34142529-34142551 AGGTCTCTGCAGCTGAAATATGG - Intronic
1026440113 7:70437034-70437056 AGGTTTTTATCTCTGAAGGACGG + Intronic
1027525287 7:79261330-79261352 AGGTCTTTCCAGCTGAAACAGGG - Intronic
1028318701 7:89435355-89435377 AGTTTTTAAGAGCTGGAGTAGGG - Intergenic
1029101390 7:98133312-98133334 AGGTTCTAACAGCTGCAGTCAGG + Intronic
1031637889 7:124123382-124123404 AGGTTTTAACATCTGAATTTGGG + Intergenic
1032991762 7:137402038-137402060 AGGTGTTGAAAACTGAAGTATGG - Intronic
1033511529 7:142064537-142064559 AGGTTGTGACAGCTGGAGAAGGG - Intronic
1033514591 7:142093565-142093587 AGGTTGTGACAGCTGGAGAAGGG - Intronic
1035438924 7:158879672-158879694 CGTGTTTTACAGCTGCAGTACGG + Exonic
1038466993 8:27773395-27773417 AGGTTTTTAAAGACGAAGAAGGG - Intronic
1039084395 8:33765543-33765565 AGCTTTTAACAGCTGAAGCTGGG + Intergenic
1043008981 8:74858158-74858180 AGGTGGTGGCAGCTGAAGTAAGG - Intergenic
1043872447 8:85449124-85449146 TTGTTTTTATAGCTGAAGGATGG + Intergenic
1044015607 8:87046083-87046105 ATGTTTTTACAGCCAAAGTAGGG - Intronic
1046024054 8:108700802-108700824 AGGTTTACACAGCTGGAGCATGG + Intronic
1047170051 8:122483965-122483987 AGTTTTGTTCAGCTGAAGTTGGG + Intergenic
1049856003 8:144862319-144862341 TGTTTTTAAGAGCTGAAGTAGGG + Intergenic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1050360916 9:4830273-4830295 AGGTTTTAAGAGCTGAGGTTGGG + Intronic
1050630791 9:7556309-7556331 AGGTTTATAAAGCTGAAGTGAGG + Intergenic
1050886371 9:10771666-10771688 AGGTTTTAGCAGGTGAAGGAAGG - Intergenic
1051160280 9:14199936-14199958 AGTCTTTTACAGCTAAAATAGGG + Intronic
1051386766 9:16517890-16517912 TGGTTTACACATCTGAAGTATGG - Intronic
1052019730 9:23511875-23511897 ACTTTGTTACAGCTGAAGGAAGG - Intergenic
1052159162 9:25234124-25234146 GGGTTCTTACAAATGAAGTAAGG - Intergenic
1052384551 9:27808093-27808115 AGTTTTTAAGAGCTGGAGTAGGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054874220 9:70078483-70078505 AAGTTTTTAAAGGTGAAGAAAGG + Intronic
1056260596 9:84844164-84844186 AGGTCTTTTCAGCTGCAGCATGG + Intronic
1057664567 9:97034807-97034829 AGGTTTTTGCTGCTGCAGTCTGG + Exonic
1058005944 9:99914372-99914394 AAGTTTCTACAACTGAAGTAGGG + Intronic
1058356641 9:104091647-104091669 AGGACTTTACCGCAGAAGTAAGG - Intergenic
1192873490 X:75206465-75206487 AGTTTTTAAGAGCTGGAGTAGGG + Intergenic
1199033712 X:143028894-143028916 AGCTTTTAAAAGCTGGAGTAGGG + Intronic
1199093733 X:143717651-143717673 AGTTTTTAAAAGCTGGAGTAGGG - Intronic
1201337689 Y:12897932-12897954 ATGTTCTTACAGCTGAAGTAGGG + Intergenic